ID: 1013722578

View in Genome Browser
Species Human (GRCh38)
Location 6:113048654-113048676
Sequence CAAGTGAATCATGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013722578_1013722582 3 Left 1013722578 6:113048654-113048676 CCCTCCTCCTCATGATTCACTTG No data
Right 1013722582 6:113048680-113048702 GACTATTCAACGCTCAGTTCAGG No data
1013722578_1013722583 6 Left 1013722578 6:113048654-113048676 CCCTCCTCCTCATGATTCACTTG No data
Right 1013722583 6:113048683-113048705 TATTCAACGCTCAGTTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013722578 Original CRISPR CAAGTGAATCATGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr