ID: 1013722823

View in Genome Browser
Species Human (GRCh38)
Location 6:113051307-113051329
Sequence TGGAGCTTTCTCGGGACATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013722816_1013722823 11 Left 1013722816 6:113051273-113051295 CCCTGACAAAGAGAGGGTTGATG No data
Right 1013722823 6:113051307-113051329 TGGAGCTTTCTCGGGACATCAGG No data
1013722817_1013722823 10 Left 1013722817 6:113051274-113051296 CCTGACAAAGAGAGGGTTGATGG No data
Right 1013722823 6:113051307-113051329 TGGAGCTTTCTCGGGACATCAGG No data
1013722815_1013722823 12 Left 1013722815 6:113051272-113051294 CCCCTGACAAAGAGAGGGTTGAT No data
Right 1013722823 6:113051307-113051329 TGGAGCTTTCTCGGGACATCAGG No data
1013722812_1013722823 26 Left 1013722812 6:113051258-113051280 CCAGAGTGAGCAGACCCCTGACA No data
Right 1013722823 6:113051307-113051329 TGGAGCTTTCTCGGGACATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013722823 Original CRISPR TGGAGCTTTCTCGGGACATC AGG Intergenic
No off target data available for this crispr