ID: 1013728024

View in Genome Browser
Species Human (GRCh38)
Location 6:113124920-113124942
Sequence ATTCACATGTTGCATATTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013728024_1013728026 8 Left 1013728024 6:113124920-113124942 CCACTAATATGCAACATGTGAAT No data
Right 1013728026 6:113124951-113124973 TAGTAACCATTTAAGTTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013728024 Original CRISPR ATTCACATGTTGCATATTAG TGG (reversed) Intergenic
No off target data available for this crispr