ID: 1013731750

View in Genome Browser
Species Human (GRCh38)
Location 6:113176404-113176426
Sequence GTGTGATTAGTTTTGGTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013731750_1013731755 4 Left 1013731750 6:113176404-113176426 CCCTTGACCAAAACTAATCACAC No data
Right 1013731755 6:113176431-113176453 AACCCCCAAATCAAGGATCCAGG No data
1013731750_1013731762 27 Left 1013731750 6:113176404-113176426 CCCTTGACCAAAACTAATCACAC No data
Right 1013731762 6:113176454-113176476 GAAGTATATACCACTCACCCTGG No data
1013731750_1013731753 -3 Left 1013731750 6:113176404-113176426 CCCTTGACCAAAACTAATCACAC No data
Right 1013731753 6:113176424-113176446 CACAGCCAACCCCCAAATCAAGG No data
1013731750_1013731756 5 Left 1013731750 6:113176404-113176426 CCCTTGACCAAAACTAATCACAC No data
Right 1013731756 6:113176432-113176454 ACCCCCAAATCAAGGATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013731750 Original CRISPR GTGTGATTAGTTTTGGTCAA GGG (reversed) Intergenic
No off target data available for this crispr