ID: 1013738573

View in Genome Browser
Species Human (GRCh38)
Location 6:113256933-113256955
Sequence GTAGCATTTGCTGGTTTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 738
Summary {0: 3, 1: 7, 2: 40, 3: 169, 4: 519}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013738573_1013738581 28 Left 1013738573 6:113256933-113256955 CCACAGAAACCAGCAAATGCTAC 0: 3
1: 7
2: 40
3: 169
4: 519
Right 1013738581 6:113256984-113257006 CTGGTTTACCAGCATACCACTGG No data
1013738573_1013738576 9 Left 1013738573 6:113256933-113256955 CCACAGAAACCAGCAAATGCTAC 0: 3
1: 7
2: 40
3: 169
4: 519
Right 1013738576 6:113256965-113256987 GTTTTCTTCCCCCAAAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013738573 Original CRISPR GTAGCATTTGCTGGTTTCTG TGG (reversed) Intergenic
900198786 1:1392937-1392959 GTAGTATTTGGGGGATTCTGGGG - Intronic
900238822 1:1605201-1605223 GTAGAATCTGCTTGTTTCCGAGG + Intergenic
900661044 1:3783895-3783917 GTAGCATTAGGCGGTTCCTGAGG + Intronic
901816536 1:11796710-11796732 GTAGCATTTTCTCTTTTCTATGG - Intronic
902101205 1:13991171-13991193 GTAGCATTTGCTGGCTTCCATGG + Intergenic
902125983 1:14211727-14211749 GTAGCATTTGCTTATTTCCATGG - Intergenic
902268040 1:15282817-15282839 GTAACATTCCCTGATTTCTGTGG + Intronic
902755252 1:18545210-18545232 GTAGCATTTGCCAATTTCCGTGG - Intergenic
903529032 1:24015475-24015497 ATAGCATTTGTCGATTTCTGTGG + Intergenic
903693404 1:25190484-25190506 GTAGTGTTTGCCAGTTTCTGTGG + Intergenic
904844731 1:33401587-33401609 GTAGTATTTGCTGATTTCCATGG - Intronic
905133537 1:35779872-35779894 GTAGCATTGTATAGTTTCTGAGG + Intergenic
905289087 1:36909262-36909284 GTAGTATCTGCTTATTTCTGTGG - Intronic
905458624 1:38106085-38106107 GTAGCATTTGCCAATTTCTGTGG - Intergenic
905714915 1:40140884-40140906 GTAGCATTTGCTGATTTCCACGG - Intergenic
905856875 1:41320239-41320261 GTGGCATTTGATGGATTCTCTGG + Intergenic
905865636 1:41374973-41374995 GTAGCTGTTGCTGCTTTCTGTGG - Intronic
906112498 1:43333524-43333546 GTAGCATTTGCTGCTTTTTGTGG - Intergenic
906329497 1:44873065-44873087 GAAACATTTGCTAATTTCTGTGG - Intronic
906635563 1:47407940-47407962 GTAGCATTTGTCAATTTCTGTGG + Intergenic
906660128 1:47576045-47576067 GGGGAATTTGGTGGTTTCTGAGG - Intergenic
907037779 1:51231552-51231574 GTAACATTTGCTGATTTCCAAGG + Intergenic
907331809 1:53676540-53676562 GTAGACTGTGCTGGATTCTGGGG - Intronic
907777443 1:57531778-57531800 GTAGCATTTGCTTATTTCTGTGG + Intronic
908049671 1:60215302-60215324 GTAGCATTTGCCAATTTCTATGG + Intergenic
908051191 1:60232786-60232808 GTAGCATTTGCTAATTTCCTTGG + Intergenic
908096868 1:60748483-60748505 GTAGTATTTGCCAATTTCTGTGG - Intergenic
908618156 1:65946377-65946399 GTAGCATTTGGTGGCTTCTATGG + Intronic
909066855 1:70945881-70945903 TTTGCATTCTCTGGTTTCTGAGG - Intronic
909852756 1:80489255-80489277 TTATCATTTACTAGTTTCTGGGG + Intergenic
909901925 1:81148574-81148596 GTAGAAATTGCTGGTTTGTAGGG - Intergenic
910363240 1:86436309-86436331 GTAGCAACTGCCAGTTTCTGCGG - Intronic
910496290 1:87832386-87832408 GTAGCATTTGCCATTATCTGTGG + Intergenic
910527201 1:88193999-88194021 GTAGCATTTACTGATTTCCCTGG - Intergenic
910813946 1:91269123-91269145 GTAGTATTTGCTGATTCCTATGG + Intronic
912082429 1:105952817-105952839 TAAACATTTGCTGATTTCTGGGG - Intergenic
913083073 1:115408020-115408042 GTAGCATTTGCTGATTTCCTTGG - Intergenic
914861139 1:151387126-151387148 GTAGCATTTGCCAGTTTCTGTGG + Intergenic
914905854 1:151743068-151743090 GTAGCATTTGCTGATTTCCATGG - Intergenic
915078863 1:153337523-153337545 ACAGCATATGCTGATTTCTGTGG + Intronic
915812233 1:158925519-158925541 GTAGCAATTGCCGATTCCTGTGG - Intergenic
916377684 1:164173310-164173332 GTGGCTTTTGCTGATTTCTGTGG - Intergenic
917185942 1:172355558-172355580 GTAGCATTTGCTAATTTCCATGG + Intronic
917288056 1:173442133-173442155 GTAGTATTTTCTGCTTTCTATGG + Intergenic
917742232 1:177971911-177971933 GTAGCAGTTGCCAATTTCTGTGG - Intronic
917762583 1:178179166-178179188 GTAGTGTTTGCTGATTTCTGTGG + Intronic
917982217 1:180277107-180277129 GCAGTGTTTGCTGCTTTCTGGGG - Exonic
918116245 1:181500437-181500459 GTAGCATTTGCAAATTTCTGGGG - Intronic
918496605 1:185145915-185145937 GTAGTATTTGCAGATTTCTGTGG + Intronic
918551626 1:185749043-185749065 GTAGCATTTGCCAGTTTATATGG + Intronic
921014458 1:211175712-211175734 GCAGTATTTGCTTGTTTCTGTGG - Intergenic
921032737 1:211347931-211347953 GTAGCATTTGCCGATTTCTGTGG - Intronic
921132860 1:212234587-212234609 GTGTCCTTTGCAGGTTTCTGGGG + Intergenic
921320470 1:213933735-213933757 GTGGCATTTGTTGTTTTCTGAGG - Intergenic
922321500 1:224492219-224492241 GTTGCATTTGCCAATTTCTGTGG - Intronic
922547260 1:226467176-226467198 GTAGTATTTGCCCATTTCTGTGG - Intergenic
923258233 1:232240932-232240954 GTAGTATTTGCCAGTTTCTGTGG - Intergenic
923294161 1:232576939-232576961 GTAGCAGAGGCTGGTTTGTGAGG + Intergenic
923811930 1:237328118-237328140 GTAGCATTTGCCCATTTCTGTGG - Intronic
924020411 1:239775559-239775581 GTAGCAGTTGCTGTTTTCTCTGG + Intronic
924291398 1:242540281-242540303 GTAGTATTTGCTGATTTCCATGG - Intergenic
924452529 1:244190994-244191016 GCAGCATTTGCTGATTTACGTGG + Intergenic
924523557 1:244826757-244826779 GTAGCATTGTTTGATTTCTGTGG + Intergenic
924747043 1:246845827-246845849 GCAGCATTTGCTGATTTCTAAGG + Intronic
1062763048 10:41862-41884 CCAGCATTTGCTGTTCTCTGGGG - Intergenic
1063214911 10:3915546-3915568 GTAGTATTGTCTGATTTCTGTGG - Intergenic
1063364894 10:5484325-5484347 GTAGCATTTGCCAATTGCTGTGG + Intergenic
1063549412 10:7015651-7015673 GTAGCATTTGTCAGTTTCTGTGG + Intergenic
1063992266 10:11578954-11578976 GTAGTGTTTGCTAATTTCTGTGG - Intronic
1064088630 10:12364740-12364762 GTAGCTCTTGCTGATTTCTGTGG + Intronic
1064150940 10:12864238-12864260 GTAGCATTTGCTAATTTCCATGG - Intergenic
1064449400 10:15427646-15427668 GTAGCATTTGTCTGTTTCTGTGG - Intergenic
1064678860 10:17789014-17789036 GTAACATTTGCCAGTGTCTGTGG + Intronic
1064792718 10:18976280-18976302 GTAGCATTTTCTGATTTCCAAGG + Intergenic
1065017620 10:21476395-21476417 GTAGCATTTGCTGATGTCTGTGG + Intergenic
1065148646 10:22799115-22799137 GTAGCTTTTGCTGATTTCTGTGG + Intergenic
1065761766 10:28989284-28989306 GTAGTGTTTGGTGATTTCTGTGG - Intergenic
1065763778 10:29007937-29007959 GAAGCATTTGCTGATTTCCGTGG + Intergenic
1066530367 10:36331563-36331585 GTAGCATCTGCCAGTTTCTGAGG + Intergenic
1067271836 10:44798427-44798449 ATATCATTTGTTGGATTCTGAGG - Intergenic
1067283385 10:44890102-44890124 ATAGCATTTGCCAATTTCTGTGG - Intergenic
1067959497 10:50832268-50832290 GTAGCATTTGCCAGTTTCCATGG - Intronic
1068227877 10:54130260-54130282 GTTGTATTTGATGATTTCTGTGG + Intronic
1069077530 10:64053407-64053429 GTAGTGTCTGCTGATTTCTGTGG + Intergenic
1069270141 10:66516589-66516611 GTAGCATTTGTTTATTTCTGTGG - Intronic
1069624971 10:69861998-69862020 GTAGCTTTTGCCAATTTCTGTGG + Intronic
1070248696 10:74754662-74754684 GAGGCATTTGCAGATTTCTGTGG + Intergenic
1070699123 10:78586334-78586356 GAAGCATTTGCTGATTTCCATGG + Intergenic
1070712434 10:78692462-78692484 GTAGCATTTGCCAATTTCTGTGG + Intergenic
1071181459 10:82989092-82989114 GCAGTATTTTCTGGTTTATGGGG - Intergenic
1072306196 10:94109721-94109743 GTAGAATTTGCTGGTTGCAGAGG - Intronic
1072382374 10:94888419-94888441 GTATCATTTTCTTCTTTCTGAGG + Intergenic
1072393294 10:95012003-95012025 GTATCATTTTCTTCTTTCTGAGG + Intergenic
1072839092 10:98750576-98750598 GTAGAAGTGGTTGGTTTCTGGGG + Intronic
1073278136 10:102330716-102330738 GTAGCTGTTGCTGATGTCTGAGG + Intronic
1073536696 10:104283020-104283042 ATAGCATTTGCTGATTTGGGTGG + Intronic
1073731719 10:106295876-106295898 TTAGCAATTGCTGGTTAGTGGGG - Intergenic
1074220962 10:111437538-111437560 GTAGCATTTGCTGATGTCCATGG - Intergenic
1074406257 10:113182505-113182527 GTGGCATTTGCCAGTTTCTGTGG + Intergenic
1074420549 10:113305082-113305104 GTAGCATTTGCTGATTTCCATGG - Intergenic
1074484797 10:113864915-113864937 GTAGCATTTGTTGATTTCCATGG - Intronic
1074587618 10:114783740-114783762 GTAGCATTTGCTGATTTTTGTGG + Intergenic
1075279901 10:121130321-121130343 GTAGCATTTGCCAATTTCTGTGG - Intergenic
1075473890 10:122716347-122716369 GTAGCCTCTGCTGCATTCTGAGG - Intergenic
1075532139 10:123238656-123238678 GTAGCATTTGCAGATTTCGGTGG - Intergenic
1075659905 10:124186031-124186053 GTTGCATTTGCAGATTTCTGTGG + Intergenic
1075766613 10:124898504-124898526 GTAGCATTTGCTGGTTGCCATGG - Intergenic
1075960381 10:126563079-126563101 GTAGCATTTGCCACTTTCTGTGG - Intronic
1076032599 10:127172310-127172332 GTAGCATCTGCTGATTTCCATGG - Intronic
1076848450 10:133081485-133081507 GCTGCATGTGGTGGTTTCTGTGG + Intronic
1076870971 10:133194743-133194765 GTAGCGTTTGCTGCTTTCCCTGG - Intronic
1077025077 11:436496-436518 GATGCATTTCCTGGCTTCTGTGG - Intronic
1077834215 11:5910276-5910298 GGAGCAGGTGCTGGTATCTGTGG - Intronic
1078925250 11:15868982-15869004 GCAGCAGTTGCTGGGTGCTGAGG + Intergenic
1080430806 11:32197563-32197585 GTAGTGTTTGCTGATTTCTTTGG - Intergenic
1080735082 11:35006128-35006150 GTAGTATTTGCTGATTTCGGTGG + Intronic
1081235257 11:40639412-40639434 GTAATATTTGCATGTTTCTGTGG - Intronic
1081351103 11:42053288-42053310 GTAGCATTTGCCAATTTATGTGG + Intergenic
1081764486 11:45600090-45600112 GTAGGACTTGGTGGTCTCTGTGG - Intergenic
1082691556 11:56310588-56310610 GTGGAAGTTGCTGGTTTTTGTGG + Intergenic
1082771952 11:57214594-57214616 GTAGTATTTTCAGGGTTCTGTGG + Intergenic
1083642576 11:64153330-64153352 GTAGCCTTTGCTGTTTGCCGTGG - Intronic
1084684843 11:70687517-70687539 GTAGCATTTACTGATTTCAGTGG - Intronic
1084955810 11:72690926-72690948 CTGGCATTTGTTGGTTTATGCGG - Intronic
1085157946 11:74313189-74313211 GTGGCATTTGCCAATTTCTGTGG + Intergenic
1085330194 11:75642253-75642275 GTAACATTTGCTGATTTCCAGGG - Intronic
1085516470 11:77114824-77114846 GTAGCATTTGCTAATTACTGTGG + Intronic
1085700494 11:78741348-78741370 GCAGCGTTTGCTCATTTCTGTGG + Intronic
1086219876 11:84429612-84429634 GTAGTATTTGCTTATATCTGAGG - Intronic
1086512937 11:87579700-87579722 GTCACATTTGCTGATTTCTGTGG - Intergenic
1087084359 11:94201401-94201423 GCAGCTGTTGCTGGTTGCTGTGG - Intergenic
1087833340 11:102844152-102844174 GTTGGATTTGCTGGTTCTTGAGG + Intergenic
1088035069 11:105301356-105301378 GTTGCATATGCAGGATTCTGGGG - Intergenic
1088714936 11:112540567-112540589 GTCGCATTTTCAGATTTCTGTGG + Intergenic
1089127309 11:116185751-116185773 GTAGCATTTGCTGCGCTCAGGGG + Intergenic
1089194746 11:116687682-116687704 GTAATGTTTGCTGATTTCTGAGG - Intergenic
1089566430 11:119374157-119374179 GCAGCAGGTGCTGGTGTCTGGGG - Intronic
1089783802 11:120893754-120893776 GTAGCATTTGCCAATTTCTGTGG - Intronic
1090851465 11:130574394-130574416 GCAGCATCTGCTGATTTCTGTGG + Intergenic
1090869637 11:130731897-130731919 GTATTGTTTGCTGATTTCTGTGG + Intergenic
1091647563 12:2285314-2285336 GTAGCATATGCCAGTTTTTGTGG - Intronic
1091832795 12:3562017-3562039 GTCGCCTTTGCTGAATTCTGTGG - Intronic
1091971021 12:4787219-4787241 GAAGCATTTGTTGTTCTCTGAGG - Intronic
1092039300 12:5369559-5369581 GTAACATTTGCCAATTTCTGTGG - Intergenic
1092123255 12:6058876-6058898 GGGGCATCTGCTGGTTTCTACGG + Intronic
1092853356 12:12650571-12650593 GTAGTATTTGCCAATTTCTGGGG + Intergenic
1093876643 12:24356362-24356384 AAAGCATTTGCATGTTTCTGTGG - Intergenic
1094050513 12:26215581-26215603 GTAGCATTTGCTAATTTCCATGG - Intronic
1094140521 12:27176482-27176504 GTATCATTTGCTGAATTCTGTGG - Intergenic
1094366312 12:29686455-29686477 GTATTATTTGCTCATTTCTGTGG + Intronic
1094376120 12:29789220-29789242 ATAGCATTTGCTGATTTCCATGG + Intergenic
1094812948 12:34159544-34159566 CCAGCATTTGCTGTTTTCTGGGG - Intergenic
1095455673 12:42383235-42383257 GTAGCATTTGCTGATATCTGTGG + Intronic
1095596410 12:43964007-43964029 GTTGGATTTGCTTGTTACTGAGG - Intronic
1095666703 12:44810563-44810585 GTAGCATCTGCTGATTTCCATGG + Intronic
1096582021 12:52591868-52591890 GTGGCGGTGGCTGGTTTCTGAGG - Intronic
1096900414 12:54873111-54873133 ATAGCATTTTTTGGTTTCTAGGG + Intergenic
1097917644 12:65037892-65037914 GTATCATTTGCTAGTTTCCTTGG + Intergenic
1097943500 12:65339446-65339468 TTAGTATTTTCTGATTTCTGTGG + Intronic
1097997218 12:65901132-65901154 GTAGCATTTGCCAATTTCTGTGG - Intronic
1098378327 12:69841449-69841471 GTAGCATTTGCTCATTTCCATGG + Intronic
1099567759 12:84274714-84274736 GTAGTATTTGCTGATTTTTATGG - Intergenic
1099608609 12:84836837-84836859 GTAGCATTGGCTGAATTCTGTGG + Intergenic
1099676240 12:85764308-85764330 GTAGCAGTTCTTGATTTCTGTGG - Intergenic
1100235743 12:92659011-92659033 GTAGCATTTGCCAGTTTCCATGG + Intergenic
1100422253 12:94446893-94446915 TCAGCATTTGCAGGTTTCTTTGG - Intronic
1101157427 12:101940962-101940984 CTGTCCTTTGCTGGTTTCTGTGG - Intronic
1101322909 12:103688972-103688994 GTAGTATTTACTGATTTCTATGG - Intronic
1101800682 12:108019375-108019397 GAAGCAGTTGGTGGTTGCTGGGG - Intergenic
1102226335 12:111230800-111230822 GTAGCATCTGCTCATTTCTGTGG + Intronic
1102318831 12:111913235-111913257 GTATCATTTGCCTGTTTCTGTGG - Intergenic
1102626309 12:114238002-114238024 GTAGTATTTGCCAGTTTCAGTGG + Intergenic
1103575653 12:121875345-121875367 GTAGCATTTCCTGAATTCTGTGG + Intergenic
1103643593 12:122372763-122372785 GCAGGATTTGCTGTTTTGTGTGG - Intronic
1104823567 12:131693064-131693086 GTGGCATTTGCCAATTTCTGTGG - Intergenic
1104929730 12:132332256-132332278 CTAGCATTTGCTGGATTTTTAGG + Intergenic
1105581217 13:21698312-21698334 GCTGCATTTGCTGTTTTCTAAGG + Intronic
1105634262 13:22202124-22202146 GTAGCATTTGCCAGTTACTGTGG - Intergenic
1105869292 13:24489836-24489858 GCAGCATTTGCTGATTTCCATGG + Intronic
1105902197 13:24764777-24764799 TTAGCATTTTGTTGTTTCTGTGG + Intronic
1107986269 13:45779030-45779052 GTAGCATTTGCTAATTTCCATGG + Exonic
1108748565 13:53421489-53421511 TTACCTTTTTCTGGTTTCTGGGG - Intergenic
1109481523 13:62961630-62961652 CTGGCATTTCCTTGTTTCTGGGG + Intergenic
1109918503 13:69023764-69023786 GTAGCATTTTCTGATTTTCGGGG + Intergenic
1110278807 13:73668807-73668829 GTAGCATTTGCCAATTTCTGGGG + Intergenic
1111588675 13:90315035-90315057 TTAGCATTTTCAGGTTTCTATGG + Intergenic
1112037461 13:95509967-95509989 GTAGCATTTGTCATTTTCTGTGG + Intronic
1112141423 13:96648139-96648161 GTAGCATTTGCCAATTTCTCTGG - Intronic
1112317923 13:98381028-98381050 GAGCCACTTGCTGGTTTCTGGGG - Intronic
1113295569 13:108955506-108955528 GCACAATTTCCTGGTTTCTGTGG + Intronic
1114669708 14:24402684-24402706 GTCGCATTTGCCAATTTCTGTGG - Intronic
1114739500 14:25080752-25080774 GTAGCATTTTGTGACTTCTGAGG - Intergenic
1114842592 14:26282701-26282723 GTGGTATTTGCTGATTTCTGTGG + Intergenic
1115510882 14:34136944-34136966 CTAGCCTTTCCTGGTATCTGAGG - Intronic
1115649860 14:35395315-35395337 GTTGCATTTGCTTGTTTGTTTGG + Intergenic
1115695146 14:35889725-35889747 GTAGCATTGGCTAATTTCTATGG + Intronic
1116728928 14:48597522-48597544 GAAGCATTTGCTGATTTCTGTGG + Intergenic
1116832795 14:49738809-49738831 GTAGCATTTGCCGATTTCCAAGG + Intronic
1116923552 14:50608442-50608464 GTAGCATTTGCCAATTTCTGTGG - Intronic
1117013597 14:51495510-51495532 GTATTTGTTGCTGGTTTCTGAGG - Intronic
1117017204 14:51530325-51530347 GTGGCATTTGCCAGTTTCTGTGG - Intronic
1117076173 14:52106914-52106936 GTAGCATTTGCTGATTTTTTTGG + Intergenic
1117855751 14:60030702-60030724 GTAACATTTGCCAATTTCTGTGG + Intronic
1118741755 14:68744794-68744816 GTAGCTGTTGCTGGTCCCTGCGG - Intergenic
1119079068 14:71675065-71675087 GTAGTATTTGCTGATTTCTATGG + Intronic
1119359351 14:74035249-74035271 GTAGCATTTGCTGATTCTGGGGG + Intronic
1119651915 14:76390007-76390029 GTAGCATTTGCCAATTTCCGTGG - Intronic
1120912342 14:89678689-89678711 GTATCATTTGCCTATTTCTGTGG - Intergenic
1120956545 14:90088364-90088386 ATAGCATTTGCCTATTTCTGTGG + Intronic
1121532704 14:94668750-94668772 GTAGCATTTGCCAGATTCTTTGG + Intergenic
1121725279 14:96142992-96143014 GTAGTATTTGCTGATTCCTGTGG - Intergenic
1121736222 14:96220028-96220050 GTAGCATTTGCAAATTTCTATGG - Intronic
1122279415 14:100612365-100612387 GTAGCATCTGGAGGCTTCTGGGG - Intergenic
1122549872 14:102544157-102544179 GGAGCCTTTGCTGGCATCTGGGG - Intergenic
1122667610 14:103343917-103343939 TTTGCATTTGCTGGTTACTCCGG - Exonic
1124890390 15:33726736-33726758 CTAGCATTTGCCCATTTCTGTGG + Intronic
1125156468 15:36592334-36592356 GTACCATTTGCCAATTTCTGTGG - Intronic
1126982535 15:54260260-54260282 GTAGTATTAGCAGATTTCTGTGG - Intronic
1127343957 15:58075170-58075192 GTTTTAGTTGCTGGTTTCTGGGG + Intronic
1127599605 15:60522352-60522374 GTAACATTTGCCAATTTCTGTGG - Intronic
1129185624 15:73904471-73904493 GTAGCAATTGCCAATTTCTGTGG - Intergenic
1129327261 15:74807336-74807358 ATAGCATTTGCTGATATCCGCGG + Intergenic
1129747410 15:78033717-78033739 GTATCATTTGGTGTTTTCTGAGG + Intronic
1129950807 15:79589545-79589567 GTCTGATTTGATGGTTTCTGAGG - Intergenic
1130069007 15:80630771-80630793 GTAACATTTGCTGATTACCGAGG - Intergenic
1130380542 15:83368438-83368460 ATAGCATTTGCTGATTTCTGTGG + Intergenic
1130834649 15:87637781-87637803 GTAGCATTTGCTGATTTGCATGG + Intergenic
1132001736 15:98187376-98187398 GTAGCATTTGCTGATTCCTGTGG - Intergenic
1132171168 15:99657234-99657256 GTAGAATTTCCTGGATTGTGTGG + Intronic
1132307696 15:100828742-100828764 GAAGGTTTTGCTGGTTTCTGTGG - Intergenic
1132897244 16:2234878-2234900 GGAGGAGTTGCTGGTGTCTGAGG + Exonic
1132920741 16:2390140-2390162 GCAGCTTTTGCTGATGTCTGTGG + Intergenic
1132998500 16:2836826-2836848 GTAGCTTTTGCTGTTGGCTGAGG + Intronic
1133732140 16:8587087-8587109 GTAGCATTTGCCTATTTCTGTGG - Intronic
1133799792 16:9075871-9075893 GTAGCATTTGCCAATTTCTATGG + Intergenic
1133805341 16:9122405-9122427 GTAGCATTTGCTTGTGTTTTAGG + Intergenic
1134185754 16:12083799-12083821 GAAGCATTCGCTGCTTTGTGGGG - Intronic
1134876710 16:17706718-17706740 GTAGCATTTGCCAATTTCTATGG + Intergenic
1135292126 16:21248969-21248991 GTAGCATGTGCCAATTTCTGTGG - Intronic
1135871612 16:26156453-26156475 GCAGCATTTGCTGGTGGATGTGG + Intergenic
1135894464 16:26386382-26386404 GTAGCACTTATTGGTTTCAGAGG - Intergenic
1136023033 16:27452037-27452059 GTAGCATTTGCTTATTTCCATGG + Exonic
1137411717 16:48234105-48234127 GTAGCCTTTGCCTATTTCTGTGG + Intronic
1137570301 16:49561249-49561271 GTAGCCTTTGCCGATTTCTGTGG - Intronic
1138137150 16:54532965-54532987 GTAGTTTTTGCTGGTTTATAAGG + Intergenic
1138192122 16:55022182-55022204 GGAGCAGGTGCTGGTATCTGTGG - Intergenic
1139658840 16:68406295-68406317 GTACCATTTGATGGTGTCTGTGG + Intronic
1139791771 16:69443350-69443372 GGAAGCTTTGCTGGTTTCTGTGG + Intronic
1140621164 16:76735004-76735026 GTAGCATTTGTTAGTTTCTCTGG + Intergenic
1140737853 16:77914447-77914469 GTAGCGTTTGCTGATTTCTTTGG - Intronic
1140800757 16:78486172-78486194 GTAGTATTTGCTGATTACTGTGG + Intronic
1140900320 16:79360966-79360988 GTAGCTTTTGCCAATTTCTGTGG - Intergenic
1140919778 16:79526715-79526737 GTAGCATTTGTTCATTTCTGTGG + Intergenic
1141204206 16:81920773-81920795 GTAGCATTTGCCAGTTTCCATGG + Intronic
1141322267 16:83022517-83022539 GTAGCATCTGCCGATTTCTGTGG - Intronic
1141335383 16:83149857-83149879 GTAATATTTGTTTGTTTCTGTGG - Intronic
1141380917 16:83575882-83575904 GTACTATGTGCTAGTTTCTGGGG - Intronic
1142903930 17:3030448-3030470 GTAGCATGTACCAGTTTCTGTGG + Intronic
1143423138 17:6811891-6811913 GTAGAATTTGCCGATATCTGTGG + Intronic
1145357280 17:22171126-22171148 CTGGCATTTCCTTGTTTCTGGGG - Intergenic
1147347574 17:39812446-39812468 GTGGCATTTGCTGATTTCAGTGG + Intronic
1148487347 17:47999131-47999153 GTAGCCTTTGCTTATTTCTGTGG - Intergenic
1149016789 17:51917149-51917171 GTAGCATTTGCAGATTTCTGTGG + Intronic
1149395192 17:56234114-56234136 GTAGCATTTGCCAATTTCTGTGG + Intronic
1149416470 17:56465050-56465072 GTAGCATATGCCGGTTTCTGTGG - Intronic
1150195587 17:63294812-63294834 GTACCATTTTCTGGGTGCTGCGG + Intronic
1150667192 17:67152176-67152198 GTAGTGTTTGCTGATTTTTGTGG + Intronic
1150812236 17:68365693-68365715 GTAGCATTTGCCAATTCCTGAGG + Intronic
1150917458 17:69451299-69451321 GTAGCATTTGCTGATTTCCACGG - Intronic
1151449812 17:74191737-74191759 GTGGCATTTGCTGATTCCTGTGG - Intergenic
1151697531 17:75725249-75725271 GTAGCGTTTGCCAATTTCTGTGG - Intronic
1151877900 17:76877655-76877677 GTGGCCTCAGCTGGTTTCTGCGG + Intronic
1152955957 18:42193-42215 CCAGCATTTGCTGTTCTCTGGGG - Intergenic
1153310885 18:3675803-3675825 GTAGCATTTGCTGTTTTCCATGG + Intronic
1155178293 18:23320949-23320971 GAGGCATTTGCTGAGTTCTGGGG - Intronic
1155413336 18:25570115-25570137 GTAGCATTTTCTGATTTCCATGG + Intergenic
1156031406 18:32717409-32717431 GTAGCCCTTGGTGTTTTCTGAGG - Intronic
1156508417 18:37614367-37614389 ATGGCACTTGCTAGTTTCTGTGG + Intergenic
1156851211 18:41728828-41728850 GTAGCATTTGCCTGTTCTTGTGG - Intergenic
1156854883 18:41769988-41770010 GTAACATTTGCTGATTTTTATGG - Intergenic
1156971242 18:43159404-43159426 GTAGCATTTGCTCATTTCTCTGG + Intergenic
1157167093 18:45367712-45367734 GTAGCACTTGCTGGTTTCCATGG - Intronic
1157566576 18:48682745-48682767 GGAGCAGTTGCTGGAGTCTGGGG - Intronic
1157946590 18:51987615-51987637 GTAGCATTTGATGATTTCCATGG - Intergenic
1158051743 18:53229607-53229629 GTAGCATTTGCTGAGTTCTGTGG - Intronic
1158448520 18:57542444-57542466 GTAGCATTTGCTGATTTTCATGG - Intergenic
1159036023 18:63277673-63277695 GTAAAATTTCCTGGTTCCTGGGG - Intronic
1159641804 18:70871639-70871661 TGAGCAATTGCTGGTTTCTTTGG + Intergenic
1160866132 19:1256911-1256933 GGGGCATTTGCTGGGGTCTGGGG + Intronic
1160937098 19:1601759-1601781 GCAGCATTTGCTAGTTTAAGCGG + Intronic
1161543712 19:4867488-4867510 GTGGGATTTGCTGGACTCTGCGG - Intronic
1161804894 19:6437394-6437416 GTCACATTTGCAGGTTACTGGGG - Intronic
1162294950 19:9806994-9807016 GTAGCATTTGCAGATTACTATGG - Intergenic
1163869693 19:19809717-19809739 GCAGAAATTGCTGGTGTCTGTGG - Intronic
1163874098 19:19851942-19851964 GCAGAAATTGCTGGTGTCTGTGG - Intergenic
1163913491 19:20217286-20217308 GCAGAAATTGCTGGTGTCTGTGG - Intergenic
1163921388 19:20293031-20293053 GCAGAAATTGCTGGTGTCTGTGG + Intergenic
1163924582 19:20327826-20327848 GCAGAAATTGCTGGTGTCTGTGG + Intergenic
1163930658 19:20387675-20387697 GCAGAAATTGCTGGTGTCTGTGG + Intergenic
1163932666 19:20412273-20412295 GCAGAAATTGCTGGTGTCTGTGG - Intergenic
1163970624 19:20790471-20790493 GCAGAAATTGCTGGTGTCTGTGG + Intronic
1163975482 19:20847551-20847573 GAAGAAATTGCTGGTGTCTGTGG - Intronic
1163994587 19:21031457-21031479 GCAGAAATTGCTGGTGTCTGTGG + Intronic
1164000763 19:21096121-21096143 GTAGAAATTGTTGGTGTCTGTGG + Intronic
1164007538 19:21164341-21164363 GCAGAATTTGCTGGTGTCTGTGG + Intronic
1164102642 19:22071193-22071215 GCAGAAATTGCTGGTGTCTGTGG + Intronic
1164214447 19:23132029-23132051 GCAGAAATTGCTGGTGTCTGTGG + Intronic
1164975145 19:32567456-32567478 GTCACATTTGCTGCTTTCTGTGG - Intergenic
1166762064 19:45231169-45231191 GTAGCATTGACTGATTTCTGTGG + Intronic
1167005918 19:46776560-46776582 GTAGCAATTACTGCTTACTGGGG + Intronic
1168138846 19:54370917-54370939 GTAGCATTTGCCGATTTCTCTGG - Intergenic
1168159179 19:54497587-54497609 GTAGCATTTGCCGATTTCTCTGG + Intergenic
925395864 2:3533358-3533380 GCAGCACTGGCTGATTTCTGCGG + Intronic
925567449 2:5271641-5271663 GTTGCATCTGCTGCTTTCTGTGG - Intergenic
925835318 2:7939603-7939625 GTAGCATTTTCTAATTTCAGTGG - Intergenic
926548817 2:14275832-14275854 GTAGCATTTGCTGATTTCTGTGG + Intergenic
926597134 2:14803347-14803369 GAAGCCTCTGCTGGTCTCTGGGG + Intergenic
926755062 2:16227860-16227882 GCAGCATTTGCCACTTTCTGTGG + Intergenic
926911817 2:17858453-17858475 GTAGTGTTTACAGGTTTCTGTGG + Intergenic
927442672 2:23130322-23130344 CTCCCATTTGCTGCTTTCTGCGG - Intergenic
927614980 2:24584513-24584535 GTAGTATTTAGTGATTTCTGAGG - Exonic
927810331 2:26176875-26176897 TGGGCATTCGCTGGTTTCTGCGG - Intronic
928451230 2:31380216-31380238 ATAGCATTTGCCAATTTCTGTGG + Intronic
929330932 2:40679853-40679875 CTAGCATCTGCTAATTTCTGTGG - Intergenic
929560177 2:42951643-42951665 GTAGCACTTGCTGATTTCCATGG + Intergenic
929912472 2:46101900-46101922 GTAGCATTAACTGATTTCTATGG + Intronic
930145431 2:47997709-47997731 GCAGCAGTTGCTGATTTCTATGG + Intergenic
930186660 2:48418446-48418468 GTAGCATTTGCCAATTTCTGTGG - Intergenic
930632092 2:53764685-53764707 GTAGCACTGGCTTGTTTCTGTGG + Intronic
930697278 2:54424795-54424817 GCAGTGTTTGCTGATTTCTGTGG + Intergenic
930989234 2:57630994-57631016 GTAGCATTTACTGATTTCTATGG - Intergenic
931672932 2:64665173-64665195 GTAGCATTTGCTGATTTCTGTGG + Intronic
931997527 2:67853459-67853481 GTAGCATTGGCTGACTTCTGTGG - Intergenic
932034936 2:68234782-68234804 ATATCATTTTCTGGTTTTTGAGG - Intronic
932355328 2:71063783-71063805 GTAGCAGTTACTGATTTCTGTGG + Intergenic
932417528 2:71582697-71582719 GTAGCATTTGCTGATTTCCATGG + Intronic
932857601 2:75253551-75253573 TTAAAATTTGCTGGTATCTGAGG + Intergenic
933659111 2:84912694-84912716 GTAGCTTTTGCTGATTTCCGCGG + Intergenic
934039489 2:88116148-88116170 GTAGCATTTGCCGATTTCCTTGG + Intergenic
934972133 2:98772350-98772372 GAGGAATTTGCTGGTTTCTGTGG + Intergenic
935000310 2:99007760-99007782 GTAGCACTTGCCAATTTCTGTGG - Intronic
936734208 2:115420705-115420727 GTAGCCTTGGCTCCTTTCTGGGG + Intronic
937981695 2:127619625-127619647 ACAGCATTTGCTTATTTCTGTGG - Intronic
938945090 2:136205039-136205061 GTAGTGTTTGCTGATTTCTGTGG + Intergenic
939377655 2:141390418-141390440 GTAGGATTTGCTGGTTCATTTGG - Intronic
939851071 2:147305595-147305617 GTAGAGTTTGCTGATTTCTGTGG - Intergenic
940124288 2:150307251-150307273 GTAGCATTTGCTGATTTTCATGG + Intergenic
940517117 2:154697294-154697316 GCAGCATTTGCTTTTTACTGGGG + Intergenic
940624140 2:156150976-156150998 GTAACATTAACTGGTTTCAGGGG - Intergenic
940938632 2:159529461-159529483 GTGGCATTTACTGTTTTCTTTGG + Intronic
941184603 2:162305959-162305981 GTAGCATTTGCTAGTCTCTGTGG - Intronic
941594751 2:167461968-167461990 GTAGTATTTGCCAATTTCTGTGG + Intergenic
944137566 2:196415520-196415542 GTAGTGTTTGCTGCTTCCTGTGG + Intronic
944311559 2:198239276-198239298 GTAGCATTTGCTGTTTTCTATGG + Intronic
944954654 2:204794482-204794504 GTAGTATTTGCTGATTACCGTGG + Intronic
945132557 2:206589263-206589285 GTAGCATTTGCAAGTTTCCATGG - Intronic
945874538 2:215264492-215264514 GTAGCATTTGCCAATTTCTGTGG - Intergenic
946093252 2:217249331-217249353 TTATCATCTGCTGATTTCTGTGG - Intergenic
946630545 2:221662981-221663003 ATAGCATTTGCTGATTTCTGTGG - Intergenic
946813723 2:223554126-223554148 GTAACATTTACTGATTACTGTGG + Intergenic
948203132 2:236144076-236144098 GTAGCATTTGCCAATTTCCGTGG - Intergenic
948272358 2:236684322-236684344 GCACCATCTGCAGGTTTCTGGGG - Intergenic
948381264 2:237551362-237551384 GTAGCATGTGCCAGGTTCTGTGG + Intronic
1169050136 20:2569137-2569159 ATAGTATTTGCTGATTTCCGTGG + Intronic
1169519671 20:6357249-6357271 GTAGCATTTGCCAATTTCTGTGG + Intergenic
1169566269 20:6856736-6856758 GTAGTGTTGGCTGATTTCTGTGG + Intergenic
1169606844 20:7331445-7331467 GGAGCATTTGCTCATTTTTGTGG + Intergenic
1170148399 20:13202193-13202215 GTAACATTTGCTGATTTCAATGG + Intergenic
1170414302 20:16123761-16123783 GTAGCATTTGCCAATTTCTATGG + Intergenic
1170598135 20:17820804-17820826 GTAACATTTGCTGATTTCCCTGG + Intergenic
1170797282 20:19559943-19559965 GTAGCATTTGCAAATTTCCGTGG + Intronic
1170860140 20:20095262-20095284 GTAGCATTTGCCGATTTCTGAGG - Intronic
1171377545 20:24703632-24703654 GTAGCATCTTCTGACTTCTGTGG - Intergenic
1172404647 20:34678775-34678797 GTAGTGTTTGCTGATTCCTGTGG - Intergenic
1173085696 20:39914355-39914377 GTAGCATTTGCTGATTTTCATGG + Intergenic
1173428581 20:42965256-42965278 ATAGTATTTGCTGCTCTCTGTGG + Intronic
1174006811 20:47417409-47417431 GCAGCATTTGCCCATTTCTGTGG - Intergenic
1174055779 20:47797213-47797235 GAAGTATTTGCTGGGTTTTGGGG + Intergenic
1174173111 20:48629137-48629159 ATAGCAATGGCTGGTTTATGGGG - Intronic
1174239348 20:49120543-49120565 GTAGCATTTGTATATTTCTGTGG - Intronic
1174239551 20:49122557-49122579 GTAGCCTTTACAGATTTCTGTGG + Intronic
1174453396 20:50633377-50633399 GTAGAACTTGCCGCTTTCTGTGG - Intronic
1175465351 20:59186967-59186989 GTAGCATTTGCTGATTTTTGTGG + Intergenic
1175542439 20:59756158-59756180 GAAGCATCTGCAGGTGTCTGTGG - Intronic
1175643596 20:60652153-60652175 TTAGCATTTGCCAATTTCTGTGG + Intergenic
1177056622 21:16312781-16312803 ATAGCATTTGCTGATTTCCATGG - Intergenic
1177576857 21:22968383-22968405 GAAGCTTTTGCTGGTTTATGTGG + Intergenic
1177994779 21:28083505-28083527 GTTGCATTTGCTGATTTTTGTGG - Intergenic
1178432648 21:32530015-32530037 GTAGCATCTGCCAATTTCTGTGG + Intergenic
1178472728 21:32907818-32907840 GTAGCATTTGCAAATTTCTATGG + Intergenic
1179017004 21:37602638-37602660 GTAGTATTTGCCAATTTCTGTGG + Intergenic
1179602338 21:42488313-42488335 GTAACATTTGCCAGGTTCTGTGG + Intronic
1179830250 21:43992058-43992080 TTAGCATTTGCTTGTCTCTAAGG - Intergenic
1179831039 21:43996073-43996095 GGAGCACTTGCTGGGTTTTGAGG - Intergenic
1180113815 21:45682615-45682637 GTAGAATTTGCTGATATATGAGG + Intronic
1180623316 22:17176844-17176866 GTAACATTTGCTGATTTTTGTGG + Intergenic
1181427339 22:22852263-22852285 GTAGAGTCTGCTGGATTCTGTGG + Intronic
1181464437 22:23103245-23103267 GTAGTATTTGCCAGTTCCTGGGG - Intronic
1181826023 22:25516518-25516540 TTAGCATTAGCTAATTTCTGTGG + Intergenic
1181852067 22:25756496-25756518 GTAGCATTTGCCAATTTCCGTGG + Intronic
1182666458 22:31963884-31963906 GTTGCATTTAGTGGTCTCTGGGG + Intergenic
1182779362 22:32855375-32855397 ATAGCATTTGCCTGCTTCTGGGG + Intronic
1183412369 22:37662456-37662478 ATACCATGTGCTGGCTTCTGTGG + Intronic
1184626221 22:45732755-45732777 GTAGCATTTGCTGGTTTCCATGG - Intronic
949123520 3:417540-417562 GTAGCATTCGATGTCTTCTGTGG - Intergenic
949183335 3:1161117-1161139 GTAGCTTTTGCCAGTTGCTGTGG - Intronic
949286335 3:2410076-2410098 TTAGCACATGCTGGTTTATGAGG + Intronic
949410125 3:3754532-3754554 GTAGCGTTTGCCCATTTCTGTGG + Intronic
949597197 3:5560450-5560472 GTAGCATTTGCCAATTTCTATGG + Intergenic
949818245 3:8085583-8085605 GTAGTATTTGCCAATTTCTGTGG - Intergenic
949856423 3:8465970-8465992 GTAAAGTTTGCTGATTTCTGTGG - Intergenic
950195443 3:11006105-11006127 GCAGCATCTGCTGATTTCTGTGG - Intronic
950248696 3:11445765-11445787 GTAGTATATGGTAGTTTCTGTGG + Intronic
950318236 3:12024806-12024828 GTGGCATTTGCTGGGTTATAGGG + Intronic
950847116 3:16025527-16025549 GTAGCATTTGCTGATTTCTGTGG - Intergenic
951692442 3:25410785-25410807 GCAGTGTTTGCTGATTTCTGTGG - Intronic
951951828 3:28207191-28207213 GTTGCATTTGCTGATTTCCATGG - Intergenic
952252669 3:31670006-31670028 GTACCATTTGCCAATTTCTGTGG + Intronic
953455002 3:43034036-43034058 GTAGCATTTGCTGCTTTCCATGG - Intronic
953479698 3:43240382-43240404 GCAGGATTTGCTCATTTCTGTGG - Intergenic
953526406 3:43693311-43693333 ATAGCATTTGATGATTTCCGTGG - Intronic
953853397 3:46482989-46483011 GTAGCATTTGCCAGTTTCTGTGG + Intronic
954043150 3:47905558-47905580 CTAGAATTTGCTTGTTTGTGGGG - Intronic
955044488 3:55347156-55347178 CTGGCATTTGCTAGTATCTGTGG - Intergenic
955134321 3:56200844-56200866 GTAGTATTTGCAGATTTCTCTGG - Intronic
955251103 3:57283290-57283312 GAAGCTTATGCTGGTTTCTGGGG - Exonic
955284823 3:57629981-57630003 GTAGCATTTGCCAATTTCTGTGG + Intronic
955446315 3:59014937-59014959 TTAGTACTTGCTAGTTTCTGTGG - Intronic
955989124 3:64606305-64606327 GTAGCCCTTGCTGATTCCTGTGG + Intronic
956161370 3:66356877-66356899 CTAGCACTTGCTGGAGTCTGAGG - Intronic
956724255 3:72144171-72144193 GTAGCATTTGCCAGTTTCCGGGG + Intergenic
958543890 3:95515293-95515315 GTAGTGTTTGCTGATTTCTGTGG - Intergenic
958703750 3:97626786-97626808 GTAGCATTTGCCAATTCCTGTGG - Intronic
958722320 3:97859380-97859402 GTAGCATGTGATGGGTGCTGTGG - Intronic
959321749 3:104885655-104885677 GTAGCATTTATTCTTTTCTGTGG - Intergenic
959554849 3:107704990-107705012 GGAGTATTTGCTGTTTTCTGTGG + Intronic
960084670 3:113577862-113577884 GTAGCATTTGCCCATTTCTGTGG + Intronic
960104015 3:113774525-113774547 GAAGCATTTGCTGGGTGCGGTGG + Intronic
960231547 3:115233740-115233762 GTATCATTTGCCAATTTCTGTGG - Intergenic
960507636 3:118512795-118512817 GTAGAATTTGGGGCTTTCTGTGG + Intergenic
960900330 3:122548147-122548169 GTAGCATTTGCTGATTTCTGTGG - Intronic
960996485 3:123343750-123343772 GCAGCAAGTGCTGGTATCTGGGG + Intronic
962711232 3:138087964-138087986 GTAGCATTTGCCAATTTCCGTGG - Intronic
963136289 3:141908383-141908405 GGAGCAGTTGCAGGTGTCTGTGG - Intronic
963461509 3:145619632-145619654 GTGGCATTTGCTGATTTCTGTGG + Intergenic
964138566 3:153371551-153371573 CTAGCAATTGTTGGTGTCTGGGG + Intergenic
964192702 3:154023400-154023422 GTAACATTTGCTGGTTTCCATGG + Intergenic
964301177 3:155286872-155286894 ATAGCATTTGTTGATTTTTGTGG + Intergenic
964379779 3:156086668-156086690 ATAGCATCTGCTGATCTCTGTGG + Intronic
964861266 3:161204353-161204375 GTAGCATTTCATAGTTTCTGTGG + Intronic
965101640 3:164306312-164306334 GGAGCAGGTGCTGGTATCTGTGG + Intergenic
965666396 3:171098176-171098198 GGAGCATTTGCTGGTATTTGAGG + Intronic
965774455 3:172213951-172213973 GTAAAAATTGCTTGTTTCTGTGG + Intronic
965780204 3:172277905-172277927 GTAACACTTGCTGATTTCTTGGG + Intronic
966023339 3:175243499-175243521 GTAGCATTTGCAAATTTCTATGG - Intronic
967296458 3:187969929-187969951 ATAGGTTTTGCTGATTTCTGTGG + Intergenic
967609968 3:191492710-191492732 GTAGTATTTGCCTATTTCTGTGG + Intergenic
967839347 3:193992333-193992355 GTAGCTTTTGCTGATTTTTGTGG - Intergenic
967850020 3:194075141-194075163 GTAGCATTTTCTGATTTCCCTGG + Intergenic
968358383 3:198126042-198126064 TCAGCATTTGCTGTTCTCTGGGG + Intergenic
968436205 4:591016-591038 GTAGCATTTGCCAATTTCTGTGG - Intergenic
969195913 4:5563719-5563741 GTAGCATTTGCCAGTTTCCATGG - Intronic
969253059 4:5982627-5982649 GTAGCATTTGCCAGTTTCCATGG + Intronic
969929495 4:10616266-10616288 GTAGCATGTGCCAATTTCTGTGG - Intronic
970146764 4:13044062-13044084 TTATCATTTCATGGTTTCTGTGG - Intergenic
970204216 4:13640075-13640097 GTGGCATTTGCCAGTTTTTGTGG - Intergenic
970516474 4:16835977-16835999 GTAGTATTTGCTAATTTCTTTGG + Intronic
970850977 4:20602811-20602833 GTAGGCTTTGCTGATTTTTGTGG - Intronic
971016767 4:22497004-22497026 GTTGCCTTTGATGGTTTCTGCGG - Intronic
971091149 4:23347122-23347144 GCAGTATTTGCTGATTTCTGTGG - Intergenic
971699836 4:29956953-29956975 GGAACATTTGGTGATTTCTGGGG + Intergenic
971745466 4:30574368-30574390 CTTGCCTTTTCTGGTTTCTGGGG - Intergenic
972241008 4:37192052-37192074 GTAGCATTTGCTGATTTCCATGG - Intergenic
972973517 4:44605950-44605972 GTAGCATTTGAATATTTCTGTGG - Intergenic
973126597 4:46593359-46593381 GTAGAATTTGCTTGCTTGTGGGG + Intergenic
973131925 4:46658505-46658527 GTAGGATTTCCTCGTTGCTGTGG - Intergenic
973800607 4:54474019-54474041 GTAGCATTTGCCGATTTCTGTGG - Intergenic
974302965 4:60093457-60093479 GTAGCATTTGCTTATTTCTGTGG - Intergenic
975182265 4:71360297-71360319 ATAGCATTTGCTGGTTTCTATGG - Intronic
975890554 4:79022278-79022300 GTAGCATTTGCCAATTTCAGTGG + Intergenic
976140040 4:81981709-81981731 GTAGCTTTTGCCAGTTTCTGTGG - Intronic
976374369 4:84327247-84327269 GTTGCATTTGCTGACTTCTATGG + Intergenic
976854639 4:89589137-89589159 GTAGCATTTGCTAATTTCTGTGG + Intergenic
977429207 4:96910217-96910239 GTAGCATTTGCTGATTTCTTTGG + Intergenic
977506480 4:97909861-97909883 GTATCCTTAGCTTGTTTCTGGGG - Intronic
977988302 4:103412148-103412170 TTAGCATTTGCAGATTCCTGTGG - Intergenic
978488607 4:109285806-109285828 GTAGCATTTGCAAGTTTTTCGGG - Intronic
979305802 4:119142140-119142162 GTAGAATTTGCAAATTTCTGTGG + Intronic
979853314 4:125600468-125600490 ATAGTATTTGCTGATTTCTGTGG + Intergenic
980118128 4:128700663-128700685 ATAGCATTTGCCTGTTTCTGTGG + Intergenic
981390895 4:144190568-144190590 CTAGGATTTGCTGGGTGCTGTGG + Intergenic
981445068 4:144826561-144826583 GTAGCATTTCCTGATTTTTGTGG + Intergenic
981762088 4:148205764-148205786 GAAGCCTTTTCTGATTTCTGAGG - Intronic
982017829 4:151173159-151173181 GTAGAACTTGCTAGTTTCTATGG - Intronic
982695206 4:158591394-158591416 CTGGTATTTGCTGGTTTCTGGGG + Intronic
982736159 4:159009025-159009047 TTAGCATTTACCAGTTTCTGTGG + Intronic
983873405 4:172848560-172848582 GAAGTAGTTGCTGGTTTCTTTGG + Intronic
984557376 4:181231023-181231045 GTAGCATTTACTAATTTCTATGG + Intergenic
984808506 4:183773111-183773133 GAAACATTTGCTGGGTCCTGTGG - Intergenic
984980658 4:185277485-185277507 GTGGCATTTGCTGATCTCTGTGG + Intronic
985869214 5:2540653-2540675 TTTGGATTTGCTGGGTTCTGAGG + Intergenic
986439356 5:7765664-7765686 GTTGCTTTTGTTTGTTTCTGTGG - Intronic
986448345 5:7842808-7842830 GTAGTATTTGATGATTTCTGTGG + Intronic
986550525 5:8949384-8949406 CTTGCATTTCCTAGTTTCTGGGG - Intergenic
986769695 5:10961245-10961267 ATGGCATTTGCCAGTTTCTGTGG - Intergenic
986822902 5:11487843-11487865 GTAGTCTTTGCTCGTATCTGTGG - Intronic
987170151 5:15247048-15247070 GTAGCATTTGCTGATTTCTGTGG - Intergenic
988499780 5:31774935-31774957 GTAGCATTTGCCAATTTCTGTGG + Intronic
988713435 5:33801325-33801347 GTAGCATTTGCCAGTTTCTGGGG - Intronic
989147227 5:38260907-38260929 GCAGGATTTGCTAGTGTCTGGGG - Intronic
989545645 5:42669663-42669685 GTAGCATTTGATGGTTAATTTGG - Intronic
990345618 5:54867995-54868017 ATAGTATTTGCTGGTATCTTAGG + Intergenic
990925616 5:61018287-61018309 GTAGCATTTGCCAATTCCTGTGG - Intronic
991366433 5:65872989-65873011 GCAGCATTTGCCATTTTCTGAGG - Intergenic
991441119 5:66650374-66650396 GTAGCATTTGCCCATTTCTGTGG + Intronic
991462228 5:66871077-66871099 GTAGCATTTGCTGGTTTCCCTGG + Intronic
991730855 5:69586641-69586663 GTAGTATTTGCTGATTTCCATGG + Intronic
991807291 5:70441803-70441825 GTAGTATTTGCTGATTTCCATGG + Intergenic
991864095 5:71041215-71041237 GTAGTATTTGCTGATTTCCATGG - Intronic
991918794 5:71632686-71632708 GTGGCATTTGCCAATTTCTGTGG + Intronic
992019632 5:72609313-72609335 GTAGCATTTGTTGGTTTGCATGG - Intergenic
992497427 5:77307564-77307586 GTAGCATTTGTTGACTTCCGTGG - Intronic
992534948 5:77690567-77690589 GTAGCTTTTGCTGATTTCTGTGG - Intergenic
992552009 5:77868101-77868123 GTGGCATCTGCTGGTGGCTGTGG - Intronic
992786211 5:80173091-80173113 GTTGGAGTTGCTGTTTTCTGAGG - Intronic
993119940 5:83762550-83762572 GTAGAATTTGATGATTTCTGTGG + Intergenic
993568110 5:89500781-89500803 GTAGGAATTGCTGGGTTCTTGGG + Intergenic
993643157 5:90430719-90430741 GTAGCATTTGCCAGTATCTGAGG - Intergenic
994369303 5:98950333-98950355 GTAGCATTTGCTAACTTCTGTGG - Intergenic
995535498 5:113131666-113131688 GTAGCAGTTCCTGATCTCTGAGG - Intronic
995564730 5:113422142-113422164 GGAGCATTTGCTGATTTCCATGG + Intronic
995974996 5:118023809-118023831 GCAGCATTTGCCGATTTCTGAGG - Intergenic
996373841 5:122782006-122782028 TTAGCTTTTGCTGATTTCTGTGG - Intronic
996544662 5:124665256-124665278 GTAACATTTGCTGTTTTCTTTGG - Intronic
996695128 5:126385906-126385928 ATAGCATTTGCTATTCTCTGTGG + Intronic
996744059 5:126830112-126830134 GTAGCATTTGCTAATTTCTGTGG + Intronic
998288649 5:140890160-140890182 GTAGCATTTGCCTATTTCTGTGG - Intronic
998568913 5:143239798-143239820 GTAGCACTTGCTGATTTTGGTGG - Intergenic
999320089 5:150609088-150609110 GTAGCACCTGCCAGTTTCTGTGG + Intronic
999382098 5:151128432-151128454 ATAGCATTTGCCTATTTCTGTGG + Intronic
999714646 5:154350637-154350659 GTTGCATTTGCTGATTTCTGTGG + Intronic
999891644 5:155984573-155984595 GTAGCTTTTGCTGGTGTCTTCGG + Intronic
999940448 5:156537035-156537057 GAAGCATTTTCTGGGTTCTTTGG + Intronic
1001517284 5:172364833-172364855 GTAGCATTTGCCAATTTCTGTGG - Intronic
1001743725 5:174074046-174074068 GTAGCCTTTGCTGATTTCCATGG - Intronic
1001807691 5:174602029-174602051 GTAGCATTTGCCAGTTTCTATGG - Intergenic
1002583360 5:180224439-180224461 AAAGCATTTGCTGAATTCTGAGG + Intergenic
1002869559 6:1154762-1154784 CTAGCATTTGCCAATTTCTGTGG + Intergenic
1002908519 6:1470348-1470370 GGTACATTTGCTGGTTTCAGTGG - Intergenic
1003522549 6:6870698-6870720 GTAGCATTTGCCAATTCCTGTGG + Intergenic
1004391400 6:15212782-15212804 GTTGCATTTGCCAGTTTGTGTGG + Intergenic
1004770183 6:18772374-18772396 GTAGCATTTACTGATTTCCATGG - Intergenic
1004794524 6:19066553-19066575 GTAGCATTTGCCAGTTTCTATGG + Intergenic
1005265307 6:24106295-24106317 GCAGCATTTGCCAATTTCTGTGG + Intergenic
1005490855 6:26345652-26345674 ATAGCATTTTCTGGTGTCTAGGG + Intergenic
1006409694 6:33865533-33865555 GTAGCAGTGGTTGGTTTCGGGGG - Intergenic
1006742876 6:36321942-36321964 GTAGCATTTGCAGATTTCCATGG - Intronic
1006936347 6:37721235-37721257 GTAGTATTTGCCAGTCTCTGTGG + Intergenic
1007059277 6:38922300-38922322 GTAATATTTGCTGATTTCTGTGG + Intronic
1007446228 6:41908357-41908379 GTAGCAGTGGCTGGCTTCTTTGG - Intronic
1007733480 6:43965972-43965994 GTAGCATTTGCCAATTTCTGTGG - Intergenic
1008006817 6:46419206-46419228 GTAGCATTTGCTGACTTCCATGG - Intronic
1008684397 6:53908823-53908845 GAATCACTTGCTGGTTTTTGTGG - Intronic
1008855604 6:56082634-56082656 GTAGAATTTTCCGGTTTCTCTGG - Intronic
1008884530 6:56417879-56417901 GTGACATTTGCTGCTTTTTGAGG - Intergenic
1009460720 6:63909608-63909630 GTAGCATTTGCTGATTTCACTGG - Intronic
1009642791 6:66360299-66360321 GTACTATTTGCTGATTTCTGTGG + Intergenic
1009665132 6:66668436-66668458 GTAGCATTTGCCAGTCTCTATGG - Intergenic
1010125243 6:72423863-72423885 ATAACATTTGCCAGTTTCTGTGG - Intergenic
1010159512 6:72835984-72836006 GTAGCATTTGCCAACTTCTGTGG - Intronic
1010470628 6:76223676-76223698 GTAGCATTTGCCTGTTTTTAAGG + Intergenic
1010518405 6:76802909-76802931 GGAGCAGTTGCTGGTATCTATGG - Intergenic
1010744411 6:79544515-79544537 GTAGCATTTGCTGGTTTCTGTGG - Intergenic
1011043986 6:83061743-83061765 GAAGCATTTGTTGATTTCTTTGG - Intronic
1011897877 6:92254485-92254507 GCAGCATTTGTTGATTTCTGTGG + Intergenic
1012097527 6:94982314-94982336 GTAGCATTTGCTTATTTCCATGG + Intergenic
1012352791 6:98273677-98273699 GTAGCATCTGCAGGTCTCTGGGG + Intergenic
1012375431 6:98556305-98556327 GTAGCATTTGCTTATTTCCATGG + Intergenic
1012380279 6:98612680-98612702 CTAGCATTTTCTGATTTTTGTGG - Intergenic
1012991287 6:105929112-105929134 GTAGTATTTGCTAGTTGCTGTGG - Intergenic
1013738573 6:113256933-113256955 GTAGCATTTGCTGGTTTCTGTGG - Intergenic
1013810427 6:114039093-114039115 GTAGCATTTGCTAATGTCTGTGG - Intergenic
1014294285 6:119599588-119599610 GTAGCATTTGCTGATTTCCTTGG + Intergenic
1014391150 6:120866732-120866754 GTAGAATTTGCTTCTTTCTTAGG - Intergenic
1015066837 6:129040130-129040152 TTAACATTTTCTGGTTTCTGTGG + Intronic
1015412491 6:132910539-132910561 GTACTATTTTCTAGTTTCTGAGG + Intergenic
1015428634 6:133103228-133103250 GTAGCATTTGCTGATTACTCTGG - Intergenic
1015596333 6:134871034-134871056 GTAGCGTTTGCCATTTTCTGTGG - Intergenic
1016359932 6:143256389-143256411 ATATCATAGGCTGGTTTCTGGGG + Intronic
1016782608 6:147976483-147976505 GTAGCATTTGCTGATACCTGTGG + Intergenic
1016786312 6:148014556-148014578 GTAGCATTTGGTGATTTCACAGG + Intergenic
1018043064 6:159941914-159941936 GTATCATTCTCTGGATTCTGTGG + Intergenic
1021180075 7:17495908-17495930 GTGGCATTTGCTAATTTCAGTGG - Intergenic
1021272086 7:18601797-18601819 GTAGGATTTCCTGGTATATGAGG - Intronic
1021298705 7:18942784-18942806 GTAGTATTTGCTGATTTCTGTGG - Intronic
1021488160 7:21189577-21189599 GTAGCATTTGCCAGTTTCTTTGG - Intergenic
1021559722 7:21957781-21957803 GTAGCACTGGCTGGGTGCTGTGG - Intergenic
1021822585 7:24512845-24512867 GTAACATTTGCTGATTTCCATGG + Intergenic
1022557292 7:31311252-31311274 GTAGCATTTGCCAATTTTTGTGG - Intergenic
1022632012 7:32094152-32094174 GTAGCATTTACTGATACCTGTGG + Intronic
1022985309 7:35648452-35648474 GTAGCATTTGCTGATTTCTCTGG - Intronic
1023142067 7:37111469-37111491 GCAGCATTTGCTGGTTTCTGTGG - Intronic
1023214141 7:37843076-37843098 GTAGCATTTGCAGATTTCCATGG - Intronic
1023523602 7:41073977-41073999 GTAGCATTTGCTAATTTCCATGG + Intergenic
1023631128 7:42165297-42165319 AGAACTTTTGCTGGTTTCTGTGG - Intronic
1023655105 7:42411671-42411693 GTAGCATTTGCCAATTTCTGTGG - Intergenic
1024855019 7:53768783-53768805 GAAGGATTTTCTGTTTTCTGAGG + Intergenic
1025160332 7:56653865-56653887 GTAGAAATTGCTGGCATCTGTGG - Intergenic
1025752311 7:64304440-64304462 GTAGTATCTGCTGGGTTGTGTGG - Intergenic
1025816210 7:64914620-64914642 GCAGAAATTGCTGGTGTCTGTGG + Intronic
1026144246 7:67731982-67732004 CTGGCATTTGCAGATTTCTGTGG - Intergenic
1028725859 7:94086984-94087006 GTAGTGTTTGCTGATTTCTGTGG + Intergenic
1029014443 7:97300739-97300761 GTGGCATTTGCCAGTTTTTGAGG + Intergenic
1030557345 7:111043052-111043074 GTAGTATATGGTTGTTTCTGAGG - Intronic
1030631189 7:111897636-111897658 GTAGCATTTGCTGATTTCCATGG - Intronic
1031028718 7:116711919-116711941 GTAGCATTTGCCAATTTCTATGG + Intronic
1031128515 7:117803746-117803768 GTAGCCTTTTCTGGTTTCCTGGG - Intronic
1031360022 7:120837900-120837922 GTAGCATTTGGGGATTTCCGTGG - Intronic
1032210294 7:129907996-129908018 GTAATGTTTGCTGATTTCTGAGG - Intronic
1032469678 7:132169199-132169221 CTAGCATTTGCTGTTTTCTTAGG + Intronic
1032575188 7:133045934-133045956 GCAGTATCTGCTGGCTTCTGGGG - Intronic
1032594463 7:133225541-133225563 GTAGCATTTTCTGATTTTTGTGG + Intergenic
1032746140 7:134788372-134788394 GTAGCATGGGCTGATTTCTGTGG - Intronic
1032943700 7:136825445-136825467 GTAGCATTTACTAATTTCTATGG - Intergenic
1033256762 7:139807890-139807912 TTAGCATTTGCTGACATCTGTGG + Intronic
1033723003 7:144081969-144081991 ATAGCAAAGGCTGGTTTCTGTGG - Intergenic
1034065270 7:148130301-148130323 GTAGGAATTGATGCTTTCTGTGG - Intronic
1034120240 7:148620263-148620285 GAAGCTTTTGCTGGGTTCAGGGG - Intergenic
1035063489 7:156088266-156088288 GTAACATTTGCTGCTTTCTGTGG + Intergenic
1035079135 7:156201802-156201824 GTAGCACGTGCTGATTCCTGTGG + Intergenic
1035222936 7:157417344-157417366 GTGGTATTTGATGCTTTCTGTGG + Exonic
1035387402 7:158483390-158483412 ATAGCCTTTGCTGCTTGCTGTGG + Intronic
1035570294 8:668058-668080 TCAGCATTTGCAGGTTTCTGTGG + Intronic
1036558899 8:9884728-9884750 GTAGCATTGGCTGATTTCCACGG + Intergenic
1036975276 8:13404272-13404294 GTAGCATTTGTGGATTTCCGTGG + Intronic
1037464255 8:19143996-19144018 GTAGCATTGGCTGATTTCTTTGG - Intergenic
1037784007 8:21891776-21891798 GTAGCATTTACTGATTTCCATGG - Intergenic
1037893863 8:22638891-22638913 GTAGCTTTTGCTGGATCCTAAGG - Intronic
1038294810 8:26281486-26281508 CTAGCATTTATTGATTTCTGAGG + Intergenic
1038580236 8:28742012-28742034 GTAGTATTTGCTGATTTCTATGG + Intronic
1038950518 8:32409364-32409386 GTTGCATTTGCTTGCTTTTGGGG - Intronic
1039109863 8:34029721-34029743 GTAGCTGTTGCTGATTTCAGTGG + Intergenic
1039178048 8:34831823-34831845 GTAGTATTTGGTGGATACTGTGG + Intergenic
1039418531 8:37416811-37416833 GTAGCATTTGCCACTTCCTGTGG + Intergenic
1039644111 8:39261600-39261622 GTTGCATTTGTTGTTTTTTGAGG + Intronic
1039799753 8:40944081-40944103 GTAAAGTTTGCTGATTTCTGTGG - Intergenic
1039971724 8:42326217-42326239 GTTGCATCTGCTGGGTCCTGTGG + Intronic
1040542317 8:48371406-48371428 GTAGGGCTTACTGGTTTCTGTGG + Intergenic
1040580191 8:48691923-48691945 GTGGCATTTGCTGATTCCAGTGG + Intergenic
1042295721 8:67215423-67215445 GTAACATTTGCAGGTATCAGGGG - Intronic
1042434907 8:68752503-68752525 AAAGCATTTGTTGATTTCTGTGG - Intronic
1042449657 8:68929910-68929932 TGAGCATTTTCTAGTTTCTGTGG - Intergenic
1043308789 8:78832098-78832120 GTATCATTTGCTGATTTCTGAGG - Intergenic
1043493052 8:80768811-80768833 GTATCATTTGCTGATTTCTCTGG - Intronic
1043794377 8:84517546-84517568 GATGCATTTGCTGGTTCCTTTGG - Intronic
1044039648 8:87351360-87351382 GTAGCATTTGCTGAGTTCCAAGG - Intronic
1044554686 8:93550152-93550174 ATAGCGTTTGCCGGTTTCTGTGG - Intergenic
1044848427 8:96404722-96404744 GTAACATTTACAGGTTTCAGTGG + Intergenic
1044970802 8:97617450-97617472 GTAGCACTTGCCAGTTTCAGTGG + Intergenic
1045122805 8:99056413-99056435 GTAGTTTTTGGTGGATTCTGTGG + Intronic
1046151596 8:110233864-110233886 GAAGCATTTGCCAATTTCTGTGG + Intergenic
1046587963 8:116170780-116170802 GTTGCATTTGCTGATTTCTATGG + Intergenic
1047375140 8:124288775-124288797 ACAGCAGTAGCTGGTTTCTGTGG + Intergenic
1047430474 8:124786818-124786840 ATAGTATTTGCTGATTTCTGTGG + Intergenic
1047779062 8:128097071-128097093 GTAGCCTTTGCTGGGTACAGTGG + Intergenic
1047860888 8:128965268-128965290 GTAGTGTTTGCCAGTTTCTGTGG - Intergenic
1047954968 8:129967283-129967305 GTAGCATTTGCTGATTCCTATGG - Intronic
1048184325 8:132225684-132225706 ATAGCATTTGCCACTTTCTGTGG - Intronic
1048679697 8:136826609-136826631 GCAGCATTTTCTCATTTCTGTGG - Intergenic
1049337029 8:142092087-142092109 GTAGCATTTGCTAATTCCTGGGG - Intergenic
1050701718 9:8347181-8347203 GTAGTATTTCCTGATTTCTTTGG - Intronic
1051440638 9:17079082-17079104 ATAACATACGCTGGTTTCTGAGG - Intergenic
1052029910 9:23616920-23616942 GCAGCATTTGCTGATTTCTAAGG - Intergenic
1052479389 9:29003394-29003416 GTAGAAATTCCTGGTTCCTGTGG - Intergenic
1052693031 9:31839511-31839533 GTAGGATTTGCTGCCATCTGTGG - Intergenic
1052932779 9:34069185-34069207 GTAGCATGTGCTGATTTCTGTGG + Intergenic
1053104355 9:35397429-35397451 TTCTCCTTTGCTGGTTTCTGGGG + Intronic
1053883462 9:42618974-42618996 GTAGCATCTGGTGTTCTCTGAGG - Intergenic
1053889207 9:42675325-42675347 GTAGCATCTGGTGTTCTCTGAGG + Intergenic
1054222482 9:62426441-62426463 GTAGCATCTGGTGTTCTCTGAGG - Intergenic
1054228228 9:62482731-62482753 GTAGCATCTGGTGTTCTCTGAGG + Intergenic
1054961348 9:70973655-70973677 GTAGCATTTGCCAATTTCTTTGG - Intronic
1055240683 9:74182794-74182816 GTAGCATTAGCTGATTTCTATGG - Intergenic
1056553934 9:87673776-87673798 CTAGCATTTGCTGATTCCTGTGG - Intronic
1056569853 9:87805729-87805751 GTAGCATTTGCTGATTCTTGTGG + Intergenic
1056735627 9:89207213-89207235 GTAGTATTTGCTGATATCTGTGG - Intergenic
1057006016 9:91560636-91560658 GTTGCATTTGGGGATTTCTGTGG + Intergenic
1058083215 9:100721087-100721109 GTAGCATTGGCTGATTTCCATGG + Intergenic
1058647427 9:107143470-107143492 ATTGCATTTGCTGATTTCTATGG - Intergenic
1058806375 9:108596068-108596090 GTAGTGTTTGCTTATTTCTGTGG - Intergenic
1059412896 9:114144372-114144394 ATAGCATTTGCTAATTTCTGAGG + Intergenic
1059437030 9:114283145-114283167 GTGGTATTTGCCAGTTTCTGCGG + Intronic
1060236795 9:121869824-121869846 GCAGCATTTACTGGCTTCTAGGG - Intronic
1060504637 9:124188609-124188631 GTAGCATTTGCCAGTTTCCATGG - Intergenic
1060512684 9:124245335-124245357 GTAGAGTTTGCTGATTTCTGTGG - Intergenic
1060750846 9:126167656-126167678 GTAGCACTTGCCCATTTCTGTGG - Intergenic
1060977949 9:127776479-127776501 ATACCATCTCCTGGTTTCTGCGG + Intronic
1061883806 9:133581205-133581227 GGAGCATTTGCTGATTTTTGTGG + Intronic
1061894103 9:133638037-133638059 GGAGCATTTGCTCCTCTCTGGGG + Intronic
1061924019 9:133797239-133797261 GTAACATTTGCTGGGAACTGTGG - Intronic
1062357368 9:136171160-136171182 TTAGCACTTGCTGTGTTCTGTGG + Intergenic
1062742252 9:138182584-138182606 TCAGCATTTGCTGTTCTCTGAGG + Intergenic
1185753013 X:2629090-2629112 GTAGCACTTCCTGTTTCCTGGGG + Intergenic
1186257488 X:7738252-7738274 GTAGCAAATGCTGATTTCAGTGG - Intergenic
1186829463 X:13376287-13376309 GTAAAATTTTTTGGTTTCTGGGG + Intergenic
1186995191 X:15114012-15114034 GTAGCATTTGTTGATTCCTATGG - Intergenic
1187006057 X:15233348-15233370 GTAGTGTTTGCCAGTTTCTGTGG - Intergenic
1187592487 X:20733558-20733580 GTGGCATTTGCTAATTTCCGTGG - Intergenic
1187690565 X:21862304-21862326 GTAGCATTTGCTGGTTTCTGTGG + Intronic
1188568624 X:31555184-31555206 GTAGCATTTGCCAATTTCTGTGG + Intronic
1189061783 X:37761439-37761461 GTAGAATTTGCCCATTTCTGTGG - Intronic
1189277600 X:39798061-39798083 GTAGCATTTGCCCATTTCTGTGG + Intergenic
1189307330 X:39996693-39996715 GTAGCATTTGCTGATTTCTGTGG + Intergenic
1189578025 X:42375831-42375853 GTAACATTTGCCAGTTTCCGTGG + Intergenic
1189680987 X:43515684-43515706 GTAGCATTTGCTGATTTCCCTGG - Intergenic
1190381722 X:49845617-49845639 GTAACATTTGCCTATTTCTGTGG + Intergenic
1190454093 X:50608609-50608631 ATTGCATGTGCTGTTTTCTGGGG + Intronic
1190550411 X:51573957-51573979 GTAGAGTTTGCTGATTTCTATGG + Intergenic
1190856949 X:54305391-54305413 CTAGTATTTGCTGATTTTTGTGG - Intronic
1190868773 X:54407380-54407402 GTAGCATTTGCTGATTTCCATGG - Intergenic
1191736077 X:64389393-64389415 ATATCATTTTCTGGTTTTTGTGG - Intronic
1192271418 X:69583304-69583326 GTAGAAGTTTCTGGATTCTGGGG - Intergenic
1193478045 X:81991348-81991370 GTAGAATTTATGGGTTTCTGAGG + Intergenic
1193668902 X:84359026-84359048 ATAGTATTTGCTGATTTCCGTGG - Intronic
1193848095 X:86499902-86499924 ATAGGATTTGCTGATTTCTGTGG + Intronic
1194610558 X:96037398-96037420 GTAGCACTTGCCAATTTCTGTGG + Intergenic
1195200210 X:102542455-102542477 GTAGTATTTGCTGATTTCCATGG + Intergenic
1195868610 X:109461665-109461687 GTAGCATTTGCCTGTTTCTGCGG + Intronic
1195998174 X:110752353-110752375 GTAGCATTTGCTGGGTGCACTGG - Intronic
1196991260 X:121331005-121331027 TTAGCAATTGCAGGTGTCTGTGG + Intergenic
1198069928 X:133138289-133138311 GTGCCATTTGCTGTTCTCTGTGG - Intergenic
1198717155 X:139569723-139569745 GTACCATTTGTTGATTTCTATGG - Intergenic
1199084735 X:143615652-143615674 GGAGCTTTAGCTGTTTTCTGTGG - Intergenic
1199319058 X:146417026-146417048 GTAGCATTTGATGATTTCTGTGG + Intergenic
1199595527 X:149503690-149503712 TAAGCATCTGCTGGTTTCAGGGG - Intronic
1199735410 X:150681513-150681535 GTAGCATTTGCTCATTTCTGTGG - Intergenic
1199750363 X:150810527-150810549 TTTCCATTTTCTGGTTTCTGAGG - Intronic
1199904732 X:152213597-152213619 TTTGCATTTGCTGGTTTTGGGGG - Intronic