ID: 1013738575

View in Genome Browser
Species Human (GRCh38)
Location 6:113256942-113256964
Sequence GCCTACTTTGTAGCATTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013738575_1013738576 0 Left 1013738575 6:113256942-113256964 CCAGCAAATGCTACAAAGTAGGC No data
Right 1013738576 6:113256965-113256987 GTTTTCTTCCCCCAAAGAGCTGG No data
1013738575_1013738581 19 Left 1013738575 6:113256942-113256964 CCAGCAAATGCTACAAAGTAGGC No data
Right 1013738581 6:113256984-113257006 CTGGTTTACCAGCATACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013738575 Original CRISPR GCCTACTTTGTAGCATTTGC TGG (reversed) Intergenic
No off target data available for this crispr