ID: 1013738581

View in Genome Browser
Species Human (GRCh38)
Location 6:113256984-113257006
Sequence CTGGTTTACCAGCATACCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013738575_1013738581 19 Left 1013738575 6:113256942-113256964 CCAGCAAATGCTACAAAGTAGGC No data
Right 1013738581 6:113256984-113257006 CTGGTTTACCAGCATACCACTGG No data
1013738573_1013738581 28 Left 1013738573 6:113256933-113256955 CCACAGAAACCAGCAAATGCTAC 0: 3
1: 7
2: 40
3: 169
4: 519
Right 1013738581 6:113256984-113257006 CTGGTTTACCAGCATACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013738581 Original CRISPR CTGGTTTACCAGCATACCAC TGG Intergenic
No off target data available for this crispr