ID: 1013739795

View in Genome Browser
Species Human (GRCh38)
Location 6:113268897-113268919
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1136
Summary {0: 25, 1: 61, 2: 188, 3: 315, 4: 547}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013739795 Original CRISPR TCTTATATGGGCATGGTTTG TGG (reversed) Intergenic
901095811 1:6678434-6678456 TCATAGATGGCCCTGGTTTGGGG + Exonic
901261117 1:7871783-7871805 TCTTATATGGGCACTGTTTGTGG - Intergenic
901751034 1:11408806-11408828 TCTTCTATGGGCACAGTTTGTGG - Intergenic
901949454 1:12730492-12730514 TCTTATATGGGTGTGGTTCGTGG + Intergenic
902928284 1:19712240-19712262 TCTTATATGGACAATGTTTGTGG + Intronic
903561129 1:24228708-24228730 TATTATATGGGCCCGGTTCGTGG + Intergenic
903636112 1:24817969-24817991 TCTTATATGGGTGTGGTTTGTGG + Intronic
903881121 1:26510190-26510212 TCTTATATGGGCACAGTTTGTGG - Intergenic
904580898 1:31543580-31543602 TCTTGTATGGGTGTGGTTTATGG + Intergenic
904680947 1:32228800-32228822 TCTTACATGGTCATAGTTGGGGG - Exonic
904761294 1:32806151-32806173 TCTTATACGGGCACAGTTTGTGG + Intronic
905086213 1:35379884-35379906 TCTTACATTGACGTGGTTTGTGG + Intronic
905144161 1:35874115-35874137 TCTTATTTGGCCATGGTTCATGG - Intronic
905206730 1:36346909-36346931 TCTCCTATGGGGATGCTTTGGGG + Intronic
905260986 1:36719058-36719080 TTTTTTATGGGTATGGTTTCTGG + Intergenic
905784070 1:40738514-40738536 TCTTATATGGGTGTGGGGTGAGG - Intronic
906558889 1:46739132-46739154 TCTTATATGGGTGTGGTTCCTGG + Intergenic
907002025 1:50870668-50870690 TGTCTTGTGGGCATGGTTTGTGG - Intronic
907610360 1:55863582-55863604 TCTTATATGGGCACAGTTCATGG - Intergenic
907633162 1:56105563-56105585 TCTTATATGGGTATGGTTTGTGG + Intergenic
907685065 1:56602598-56602620 TTTTATACGGGAATGGTTTGTGG - Intronic
907965861 1:59328894-59328916 TCTTATATGGGTGCAGTTTGTGG + Intronic
908221512 1:62011502-62011524 TTTTATATGGGCACAGTTTATGG + Intronic
908473124 1:64463865-64463887 TATTATATGGGCATGGTGGCAGG + Intergenic
908605047 1:65789747-65789769 TATTTTATGGGCATGGGTAGAGG - Intergenic
908849652 1:68362960-68362982 TCTTAAATGGGTGTGATTTGTGG + Intergenic
908893199 1:68869028-68869050 TCTTTTATGGGTGTTGTTTGGGG + Intergenic
908975429 1:69891378-69891400 TCTTATATGGGCATGGTTCATGG + Intronic
909735581 1:78957081-78957103 TCTTATATGGGCATGGTTCATGG - Intronic
909844041 1:80367981-80368003 TCTTATGTGGGCATGGCTTGTGG - Intergenic
909888992 1:80979380-80979402 TCTTATATAGGCAGAGTTTGTGG + Intergenic
910018667 1:82557808-82557830 TCTTATATGGGCATCGTTCTTGG - Intergenic
910078458 1:83309255-83309277 TCTTATGTGAGCATGGTTTGTGG + Intergenic
910231755 1:84995099-84995121 TCTTATATGGGCACAGTTCATGG + Intronic
910983387 1:92980839-92980861 TCTTATATGGGTACGGTTCATGG - Intergenic
910997033 1:93116940-93116962 TCTTAGGTGGGCACGGTTTTTGG + Intronic
911173509 1:94795466-94795488 TCTTAAATTGGCATGGTTTTAGG + Intergenic
911409115 1:97479467-97479489 TCTTATATGGGCATGGTTTGTGG + Intronic
911649653 1:100373337-100373359 TCTTATTTGGGTACAGTTTGTGG + Intronic
911706300 1:101016979-101017001 TTTTATATGCGCTTGGTTTGTGG + Intronic
911897041 1:103449265-103449287 TCTTATATGGGCCTGGTTCATGG + Intergenic
911955758 1:104232895-104232917 ACTTATATGGGCATAGTTCATGG + Intergenic
911968538 1:104399291-104399313 TGTTACATGGGCATACTTTGTGG + Intergenic
912131776 1:106611869-106611891 TCTTATATGGACATGGTTCATGG + Intergenic
912902520 1:113667940-113667962 TTTTATATGGGTGTGATTTGTGG + Intronic
913127034 1:115801150-115801172 TCTTATATGGGTATGGTTTATGG + Intergenic
913350917 1:117858176-117858198 TCTTATATGGGTGCAGTTTGTGG - Intergenic
914343022 1:146776372-146776394 TCTGATATGGGCATCTTTGGGGG + Intergenic
914436161 1:147661411-147661433 TCTTATATGGGGGCGGTTTGTGG - Intronic
914977143 1:152377098-152377120 TCTTGTATGGGTGTGGTTTGTGG - Intergenic
915305614 1:154975748-154975770 TCTTCCCTGGGCTTGGTTTGGGG + Intronic
916191597 1:162184241-162184263 TCTCATATGGGCACAGTTTAAGG + Intronic
916553147 1:165869127-165869149 TTTTATATGGGCGTGGTTGGTGG + Intronic
916778813 1:168000211-168000233 TCTTATATGGATGCGGTTTGTGG + Intronic
916956896 1:169847107-169847129 TCTTATAGGGGCACAGTTTGTGG + Intronic
917192301 1:172430951-172430973 TCTTATATGGGTATAGTTTGTGG - Intronic
917353277 1:174100698-174100720 TCTTACATAGTCATGGTTTGTGG + Intergenic
917353522 1:174102855-174102877 TCTTATATGAGCGTGGTTGGTGG - Intergenic
917950879 1:180034689-180034711 TCTTAAACGGACATGGTTGGTGG - Intronic
918392092 1:184076343-184076365 TCTTATATGGGCACAATTTGTGG - Intergenic
918606169 1:186428871-186428893 TCTTATATGGGCATGGTTCATGG + Intergenic
918877391 1:190065733-190065755 TCTTATATGGGCATGTTTCATGG + Intergenic
919033976 1:192282278-192282300 TCTTATATGAGTATGGTTCATGG + Intergenic
919093908 1:193006725-193006747 TCTTACATGGGCATGGTTCATGG + Intergenic
919113295 1:193247301-193247323 TCTTATATGGGTGTGGTTTGTGG - Intronic
919123419 1:193368827-193368849 TCTTATACTGGCATGGTTTGTGG + Intergenic
919204081 1:194397640-194397662 TGTTATCTGGACATGGTTTGTGG + Intergenic
919415207 1:197300018-197300040 TGCCATATGGGCATGGTTTGTGG - Intronic
919448848 1:197745531-197745553 TATTATATGGGCATGGTTCATGG + Intronic
919548905 1:198959941-198959963 TCTTATATGGGTGTGGTTTATGG + Intergenic
919612804 1:199767002-199767024 TCTCATATGGGTACAGTTTGTGG - Intergenic
919971672 1:202584357-202584379 TCTAATAAGCACATGGTTTGGGG - Exonic
920538364 1:206757409-206757431 TCTTATATGGACACAGTTTGTGG + Intergenic
921276209 1:213523240-213523262 TCTTACATGGGCACAGTTTGTGG + Intergenic
921282000 1:213576566-213576588 TTTAATATGGGTTTGGTTTGTGG - Intergenic
921576448 1:216840825-216840847 TCTTATATGGGTATGGTTTGTGG + Intronic
922279650 1:224111602-224111624 TCTTATATGGGTATGATTGGTGG + Intergenic
922624187 1:227021055-227021077 TCTTATATGGGCATGGTTTGTGG + Intronic
922747316 1:228051656-228051678 TTTTATAAGGGCATTGTTTTAGG + Intronic
922903145 1:229153912-229153934 TCTTATATGGACATGGTTTGCGG + Intergenic
923371969 1:233323648-233323670 TCTGATATAGGTGTGGTTTGTGG - Intergenic
923481317 1:234386970-234386992 TCTTACATGGGTACAGTTTGTGG + Intergenic
924006810 1:239621175-239621197 TTTTATATGGGAGTGGTTTATGG - Intronic
924079183 1:240375143-240375165 TCTTATGTGGGCATAGTTTGTGG + Intronic
924689442 1:246331898-246331920 TCTTATATGGGGATGGTTTGTGG - Intronic
1062777233 10:162235-162257 TCTTACATAGGTGTGGTTTGTGG + Intronic
1062995609 10:1863505-1863527 CCTTCTATGGACATGGTCTGTGG - Intergenic
1063329483 10:5142692-5142714 TCTTATATGGGCACAGTTTAGGG + Intergenic
1063788543 10:9412757-9412779 TCTTTTATGGGCATGGTTCGTGG - Intergenic
1064842030 10:19603842-19603864 TCTTATATGGGCATGGTTCATGG - Intronic
1065402739 10:25324473-25324495 TATTATATGGGCATGGTTCATGG + Intronic
1065641551 10:27787447-27787469 TCTTTTATGGGAATGGAGTGGGG + Intergenic
1066237935 10:33505133-33505155 TCTTAGATGGGCACAGTTTGTGG + Intergenic
1067548119 10:47211131-47211153 TCTTGTGTGGGCATGGTTCCTGG - Intergenic
1068243940 10:54340726-54340748 TTCTACATTGGCATGGTTTGGGG + Intronic
1068248275 10:54402717-54402739 TGTAATGTGGGAATGGTTTGCGG - Intronic
1068268943 10:54694679-54694701 TCTTCTATGGACCTGGTTTGTGG - Intronic
1068748701 10:60566150-60566172 TCTTATATGGATGTGGTTTGTGG - Intronic
1068870142 10:61934667-61934689 CCTTATATCTGCATGGTTTGTGG + Intronic
1068952979 10:62795921-62795943 TCATACATTGGCATGGTTCGGGG + Intergenic
1069292396 10:66796414-66796436 TCTTATATGGGTGCAGTTTGTGG + Intronic
1069342915 10:67433308-67433330 TCTCAAATGGGCTTGGTTTTTGG + Intronic
1069398197 10:68012978-68013000 TATTATATGGATGTGGTTTGTGG - Intronic
1069666353 10:70162937-70162959 TCTTCTATGGTTGTGGTTTGTGG - Intronic
1069947207 10:71995751-71995773 TCTTCTATGGGTGTGGTTTGTGG + Intronic
1070218548 10:74414014-74414036 TCTTCTATGGGTGTGGTTTGTGG + Intronic
1070360816 10:75686972-75686994 TCTTATATGGGTAAGGTTCATGG - Intronic
1070984359 10:80675400-80675422 TCTTATATGGACATGGCTCATGG - Intergenic
1071054006 10:81487713-81487735 TCTAATATGGTCATGGTTCATGG - Intergenic
1071368997 10:84931879-84931901 TCTTATATGGGTGTGTTTTGTGG + Intergenic
1071387133 10:85132764-85132786 AATTGTATGTGCATGGTTTGAGG - Intergenic
1071400847 10:85269056-85269078 TCTTACATGGGTACAGTTTGTGG + Intergenic
1072059593 10:91797197-91797219 TCTTCTATGGGTGTGGTTTGTGG + Intergenic
1072151083 10:92684600-92684622 TCTTATATGGGTGCAGTTTGTGG - Intergenic
1072474023 10:95741356-95741378 TCTTATATGGGCATGGTTCATGG + Intronic
1072580825 10:96738991-96739013 TCTTATATGGGCACAGTTCTGGG - Intergenic
1073598997 10:104828440-104828462 TTTTATATGGGCATGGTTCATGG + Intronic
1073772284 10:106748377-106748399 TCTTATATGGTTGTTGTTTGTGG - Intronic
1073781054 10:106838926-106838948 TCTTACATGGGCATGGTTCAGGG - Intronic
1074381148 10:112981792-112981814 TCTGTTTTGGTCATGGTTTGTGG + Intronic
1074666741 10:115736606-115736628 TCTTATATGATCTTAGTTTGTGG + Intronic
1074948846 10:118308575-118308597 TCCTTTCTGGGCATGGGTTGTGG - Exonic
1076095400 10:127731180-127731202 TCTTATATGGGCACGGTTCATGG + Intergenic
1076856891 10:133121085-133121107 TCTTATACGGGCGTGGTTTGTGG + Intronic
1078193672 11:9115968-9115990 GCTTACATAGGCATGGTTTGTGG + Intronic
1078243260 11:9549978-9550000 TCTTGTATGGGCACGGTTTGTGG - Intergenic
1078626875 11:12966013-12966035 TCTGATATTGACATGCTTTGGGG - Intergenic
1078784359 11:14473615-14473637 TTTTATATGGGAATGGTTCCTGG + Intronic
1079132925 11:17759731-17759753 TCTTATACGGGTGTGATTTGTGG + Intronic
1079228414 11:18628211-18628233 TTTTATATAGGCAAGGTCTGGGG - Intronic
1079272452 11:19001004-19001026 TCTTTTATGGGCATAGTTTGTGG - Intergenic
1079343387 11:19631450-19631472 TCTTACATGGGCATTTTATGAGG - Intronic
1080171060 11:29303499-29303521 TCTCATATGGAAATAGTTTGTGG - Intergenic
1080359133 11:31492819-31492841 TCTTACATGGGCACGGTTTCTGG + Intronic
1080543856 11:33296690-33296712 TCTTATATAGGCACAGTCTGTGG - Intronic
1080842342 11:35996368-35996390 TCTTATATGGGTGTGGTTTGAGG + Intronic
1081062308 11:38494685-38494707 CCTTATATAGGTATGGTTTGAGG + Intergenic
1081062766 11:38501535-38501557 TCTAATATTTGCATGGTTTCAGG + Intergenic
1081212083 11:40348061-40348083 TGTTATATGGGCATGGATCACGG + Intronic
1081261551 11:40967660-40967682 TCTTATATGGGCATGATTTGTGG - Intronic
1081266171 11:41024998-41025020 TCTTATAAGGGCTTGGTTTGTGG - Intronic
1081485743 11:43526853-43526875 TCTTATATGGGCACAGTTCGTGG + Intergenic
1081948387 11:47019641-47019663 TCCTATATGGATGTGGTTTGTGG + Intronic
1082205354 11:49427097-49427119 TCTTATATGGATGTGGTTTGTGG - Intergenic
1082761852 11:57134872-57134894 TTGTATACGGGCATGGTTTGTGG + Intergenic
1082766647 11:57173882-57173904 TCTAAAATGGGCATGATTTTAGG - Intergenic
1082954628 11:58856730-58856752 TCTTATATGGGTGCAGTTTGTGG + Intronic
1084369218 11:68727878-68727900 TCTTATATGGATGTGGCTTGTGG - Intronic
1084369222 11:68727932-68727954 TCTTACATGGACATGGCTCGTGG - Intronic
1085436516 11:76509019-76509041 TCTTACACGAGCATGGTTTGTGG + Intronic
1085500508 11:77018286-77018308 TCTTCTATGTGCATGGTTTGTGG - Intronic
1085608576 11:77925263-77925285 TCTTATACAGGCACAGTTTGTGG + Intronic
1085616764 11:78006195-78006217 TCTTATATGGATGTTGTTTGTGG - Intergenic
1085698322 11:78724596-78724618 TCTTATATACACATGGTATGTGG + Intronic
1085858128 11:80198903-80198925 TCTTATATTGGTGTGGTTTGTGG - Intergenic
1086081966 11:82912975-82912997 TCTTATATAGGTACAGTTTGTGG + Intronic
1086187129 11:84031987-84032009 TCTTATATGGGCATATTCTGTGG - Intronic
1086318601 11:85620216-85620238 TCTTATGTGGGTATGATTTGTGG - Intronic
1086494948 11:87393293-87393315 TCTTATATGAGCCTGGTTCATGG - Intergenic
1086649751 11:89273439-89273461 TCTTATATGGATGTGGTTTGTGG + Intronic
1086734262 11:90286156-90286178 TCTTTTATGGACATAGTTCGTGG + Intergenic
1086896977 11:92324532-92324554 TCTTATATGGGTGTGGTTCGTGG + Intergenic
1086999283 11:93397297-93397319 TCTTCTTTGGGCATGGTTAATGG + Intronic
1087064497 11:94014830-94014852 TTGTATATGAGCATGGCTTGTGG - Intergenic
1087421933 11:97940046-97940068 TCTTTTATGGGCATGATTTGTGG - Intergenic
1087540564 11:99512729-99512751 TCTTATATGGGATCTGTTTGTGG - Intronic
1087577510 11:100008085-100008107 TCTTCTATGGGCATAGTTCATGG + Intronic
1087609444 11:100416119-100416141 TCTTACACGGGCTTTGTTTGTGG + Intergenic
1087644798 11:100796267-100796289 TCTTATTTGGGTAGGGTCTGTGG - Intronic
1087657816 11:100946677-100946699 TCTTATGTGGACATGGTTAATGG + Intronic
1087671201 11:101109046-101109068 TCTTACATGGGCAAGGTTTGTGG - Intronic
1087913961 11:103786474-103786496 TCTTACATGGGCATGGTTTATGG + Intergenic
1088137893 11:106579302-106579324 TCTAATATGCGTATGCTTTGTGG + Intergenic
1088156985 11:106818395-106818417 TCTTATACGGGTGTGGTTTGTGG - Intronic
1088389492 11:109298444-109298466 TCTTACATGGGCATGGTTGGTGG + Intergenic
1088439704 11:109856169-109856191 TCTTATGTGGGCATGATTCGTGG + Intergenic
1088662050 11:112057111-112057133 TCTTATATGGGCATGGTTCATGG - Intronic
1090068195 11:123521557-123521579 TCCTTTATGGGCATTGTTTTTGG + Intergenic
1090147777 11:124345016-124345038 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1090411501 11:126512828-126512850 TCTCATTTGCTCATGGTTTGGGG - Intronic
1090523117 11:127500077-127500099 TCTAATATGGGACTGGTTTGTGG - Intergenic
1090813100 11:130265027-130265049 TCTTATATGGGTGCAGTTTGTGG - Intronic
1091427105 12:400665-400687 TCTTATATGGGCATGGTTCATGG + Intronic
1091865186 12:3828019-3828041 TGTTATATGGGCATGTTTTGGGG - Intronic
1092623648 12:10302012-10302034 TCTTATATGGGCATGGTTCCTGG + Intergenic
1092824012 12:12380116-12380138 TTTTCTATGGGTGTGGTTTGTGG + Intronic
1092966159 12:13645348-13645370 TCTTATCTGGGTGTGGTTGGTGG + Intronic
1093617192 12:21240550-21240572 TATTATATGGGTATGGATAGTGG + Intergenic
1093662066 12:21768336-21768358 TCTTATATGGGCATGGCTCATGG - Intronic
1093838291 12:23864180-23864202 TCTTATATGGGTGCGGTTAGTGG - Intronic
1093969005 12:25357409-25357431 TCTCATTTAGGGATGGTTTGTGG - Intergenic
1094250416 12:28353683-28353705 TCTGATATGGGCATGGTTTGTGG + Intronic
1095168747 12:39007618-39007640 TCTTATATAGGCACGGCTTGTGG - Intergenic
1095208642 12:39467440-39467462 TCTTATATTGATGTGGTTTGTGG - Intergenic
1095466960 12:42497584-42497606 TCTTATATGGGCACAGTTCATGG + Intronic
1095523075 12:43091578-43091600 TCTTATATGAGCATAGTTTGTGG - Intergenic
1095605995 12:44068618-44068640 TCTTAAATAGGTGTGGTTTGTGG + Intronic
1095688130 12:45058966-45058988 TCTTATATGGGCACAGTTCTTGG + Intergenic
1095729022 12:45485461-45485483 TCTTATATGGGTGTGCCTTGTGG - Intergenic
1095754601 12:45750303-45750325 TCTTATGTGGGTACAGTTTGGGG + Intronic
1096434864 12:51580997-51581019 CCTTGTATGGGTATGGTTCGTGG - Intergenic
1097453281 12:59763858-59763880 TCTTATATGGGCACAGTTCATGG - Intronic
1097550019 12:61055996-61056018 TCTTATATGGGCATGTTTCATGG - Intergenic
1098344425 12:69486385-69486407 TCCTATATGGGCACAGTTTGAGG - Intronic
1098427399 12:70380289-70380311 CCTCATATGGGCATGGTTTGTGG + Intronic
1098752084 12:74306434-74306456 TCTTATATGGGTTTGGTTTATGG + Intergenic
1098785665 12:74751091-74751113 TCTTATGTGGGTATAGTTTGTGG - Intergenic
1098800728 12:74953985-74954007 TCTTATATGGGCATGTTTTCTGG + Intergenic
1099161997 12:79253398-79253420 TCTCATATGGGCATAGTTCTTGG - Intronic
1099252522 12:80273929-80273951 TCTTATATGGGCACCATTTGTGG - Intronic
1099335853 12:81356258-81356280 TCTTATATTGGCATGGTTCATGG + Intronic
1099503124 12:83438104-83438126 TCTTATATGGGAATGGTTCTTGG + Intergenic
1099937933 12:89150414-89150436 TCTTACGTGGGCATGGTTTGTGG - Intergenic
1100451991 12:94716002-94716024 TGTTAAATGGACATGTTTTGCGG - Intergenic
1100516446 12:95332860-95332882 TTTTATATGGGCTTGGTTTGTGG + Intergenic
1100695635 12:97089794-97089816 TCTAATGTGGGCACAGTTTGTGG + Intergenic
1100723488 12:97384156-97384178 TCTTGTATGGACATGGTTCATGG + Intergenic
1101489198 12:105196294-105196316 CCTTCTTTGGGCATGGTTTGAGG - Intronic
1101872347 12:108576467-108576489 TCTTACATGGGCACAGTTCGTGG + Intergenic
1102849571 12:116227604-116227626 TTTTATATGGGTGTGGTTTGTGG - Intronic
1103048118 12:117755493-117755515 TGTCATATGGGCACGGTTTGTGG - Intronic
1104096522 12:125563063-125563085 TCTCACATAGGCATCGTTTGTGG + Intronic
1104395713 12:128430786-128430808 TCTTATATGGGCACAGTTCATGG - Intronic
1104534068 12:129601742-129601764 TCTTACATGGGCATGGTTCATGG + Intronic
1104949932 12:132435144-132435166 TCTTATATGGGGACAGTTTGTGG + Intergenic
1105254563 13:18734296-18734318 CCTTATATGTGCATGTTTTGAGG - Intergenic
1105387136 13:19941540-19941562 CCTTATTTGGGTATAGTTTGAGG + Intergenic
1105393001 13:19999452-19999474 TCTCATATGGGTATGGTTTGTGG - Intronic
1105747018 13:23386939-23386961 TCTTATTTGGGCACAGTTCGTGG + Intronic
1106075640 13:26458682-26458704 TCTTAGATTGGCAAGCTTTGGGG + Intergenic
1106352847 13:28950693-28950715 TCTTATATGGGCATGGTTCATGG + Intronic
1106946646 13:34835213-34835235 TCTTATATGGGCATGGTTCATGG - Intergenic
1107068731 13:36245992-36246014 TTTTATATGGGCTTGGTTTATGG - Intronic
1107287308 13:38808668-38808690 TCTTCTATGGGCGCTGTTTGTGG + Intronic
1107689617 13:42939615-42939637 TCATTTGTGGGCAGGGTTTGTGG + Intronic
1108277981 13:48830916-48830938 TCATTTGCGGGCATGGTTTGTGG - Intergenic
1108467958 13:50737610-50737632 TCTTCTATGGGCATGGCTTATGG - Intronic
1108776456 13:53771199-53771221 TCTTATATGGGTACAGTGTGTGG + Intergenic
1108845097 13:54668575-54668597 GGTTATATGGGCATACTTTGTGG + Intergenic
1108972753 13:56397888-56397910 TCTTATATGGGCTTTGGTAGAGG - Intergenic
1109080499 13:57893725-57893747 TCTTATATGGGCACAGTTCATGG - Intergenic
1109131266 13:58589167-58589189 TCTTAAATGGGTATGGTTTATGG - Intergenic
1109254706 13:60065019-60065041 TCTAACATGGGTGTGGTTTGTGG + Intronic
1109350466 13:61174090-61174112 TCTTATGTGGGCACAGGTTGTGG - Intergenic
1109616552 13:64841454-64841476 TCATATATAAGCATGGTTTCTGG + Intergenic
1109735411 13:66478185-66478207 TCTAATATGGGCATGGCTTGTGG - Intronic
1109771241 13:66976388-66976410 TTTCATATGGGTATGGTTTGAGG + Intronic
1109815633 13:67579551-67579573 TCTTATATAGACATGGTTTGTGG + Intergenic
1109853886 13:68103396-68103418 TCTTATATGGGTATGGATTGTGG + Intergenic
1109893451 13:68650827-68650849 ATTTATATGAGCATGATTTGTGG - Intergenic
1109953251 13:69530410-69530432 TTTTATATGGTCATGGTTTGTGG - Intergenic
1110022023 13:70486875-70486897 TCTTACATTGCCATGGTTTGTGG + Intergenic
1110091216 13:71450387-71450409 TCTTATATGGGCATAGTTCGTGG - Intronic
1110300792 13:73924480-73924502 TCTTCTATGGGCAGGGTTCATGG - Intronic
1110447243 13:75599628-75599650 GCATATATGGGTATAGTTTGTGG - Intronic
1110521576 13:76485337-76485359 TTTTATATGAGCATAGTCTGTGG - Intergenic
1110766480 13:79285069-79285091 CCTTACATGGGTGTGGTTTGTGG - Intergenic
1110786350 13:79532051-79532073 TGTTCTATGGGCACAGTTTGTGG + Intronic
1110946785 13:81431455-81431477 TCTTATATTGGCACAGTTTGTGG - Intergenic
1111163555 13:84427246-84427268 TCTTATATAAGCATGGTTCCTGG - Intergenic
1111220148 13:85194367-85194389 TCTTATATGGGCACGGTTCCTGG - Intergenic
1111324240 13:86670808-86670830 TCTTATATGGGCATGGTTCGTGG + Intergenic
1111365963 13:87245512-87245534 TCTTATATGGGCAGAATTTATGG - Intergenic
1111571735 13:90096810-90096832 TTTTATATGGGCACAATTTGTGG + Intergenic
1111839941 13:93437102-93437124 TTTTATATGGGCATGATTCATGG - Intronic
1111936641 13:94564462-94564484 TCTTACATGGGCATGATATGCGG + Intergenic
1112521143 13:100096344-100096366 ACTTATATGGGCGTGGTTCACGG - Intronic
1112543864 13:100344963-100344985 CCTTACACGTGCATGGTTTGTGG - Intronic
1112556245 13:100471263-100471285 TCGTACATGGGCACAGTTTGTGG + Intronic
1112728795 13:102335905-102335927 TCTTACATGGGCACAGTTTGGGG - Intronic
1112836503 13:103521347-103521369 TCTTCTATGGGCATGGTTCATGG - Intergenic
1112856706 13:103779657-103779679 TCTTATATGAGCATGGTTCATGG + Intergenic
1112939501 13:104844269-104844291 TCTTATATGAGTGTGATTTGTGG + Intergenic
1113304448 13:109061609-109061631 TCTTATATCGGTGTGGTTTGTGG + Intronic
1113554956 13:111225710-111225732 TCTTACATGGGCATGGTTCATGG - Intronic
1113648976 13:112020703-112020725 TCCTGTATGGGCATGGTTTATGG - Intergenic
1113695023 13:112339153-112339175 TCTTATATGGGCACTGTTTGTGG - Intergenic
1114211199 14:20616642-20616664 TCTTATATGGGCTTTGGTAGGGG + Intergenic
1114601980 14:23964009-23964031 TCTTTTCTGGGTGTGGTTTGTGG + Intronic
1114606151 14:23999133-23999155 TCTTTTCTGGGTGTGGTTTGTGG + Intronic
1114611723 14:24046712-24046734 TCTTTTCTGGGTGTGGTTTGTGG + Intergenic
1114734261 14:25027401-25027423 TCATTTTTGGGCATGGTTTGTGG - Intronic
1115013124 14:28574505-28574527 TCTCATATGGACATGGTTTATGG + Intergenic
1115019000 14:28651973-28651995 TCTTTTATGGGTGTGGTTTATGG - Intergenic
1115109997 14:29810099-29810121 TCTTATATGGGCACAATTTTTGG + Intronic
1115154669 14:30324333-30324355 TCTTATTTGGATGTGGTTTGTGG - Intergenic
1115293567 14:31800366-31800388 TATTATATGGGTGTGGTTTGTGG + Intronic
1115379156 14:32714168-32714190 TCTTATATGGGTGTGGTTTGTGG + Intronic
1115486796 14:33918224-33918246 TCTTATATGGGCACAGTTTTTGG - Intergenic
1115542073 14:34430321-34430343 TGTTAAATAGGGATGGTTTGTGG - Intronic
1115881771 14:37927376-37927398 CCTTATCTCGGGATGGTTTGGGG + Intronic
1116193761 14:41694818-41694840 TCTTGTATGGGAATGTTTTTTGG - Intronic
1117078264 14:52125768-52125790 ACTGATATGGCCATGATTTGGGG - Intergenic
1117231239 14:53720975-53720997 TCTTATATGGGCACAGTTCGTGG - Intergenic
1117370324 14:55072670-55072692 TATTAGATGTGCATTGTTTGGGG - Intergenic
1117764498 14:59066894-59066916 TCTTATTTGGTCATGGTTGGTGG + Intergenic
1117887013 14:60374990-60375012 TCTTATATGGGCATGGTTCATGG - Intergenic
1117932304 14:60855853-60855875 TCTTATATGGGTGTGGTTCCTGG - Intronic
1117935398 14:60899969-60899991 TCTTATACGGGTACAGTTTGTGG - Intronic
1118037942 14:61888548-61888570 TCTTATATGGGTGCAGTTTGTGG + Intergenic
1118260603 14:64243259-64243281 GCTTATATGGGCATAGTTTGTGG + Intronic
1118459497 14:65975743-65975765 TTTCATAAGGGCATGATTTGAGG + Intronic
1118553169 14:66980016-66980038 TCTTACATGGGCACCATTTGTGG + Intronic
1119017294 14:71071998-71072020 TCTTATATGGGCATAAATTGTGG + Intronic
1119883383 14:78119999-78120021 CCTTCTGTGGGCATGGTTGGTGG + Intergenic
1120174986 14:81284025-81284047 TCTTATATGGGCACAGTTTATGG - Intronic
1120264678 14:82233912-82233934 TTTTATATGGGCATGGTTTCTGG - Intergenic
1120318715 14:82931169-82931191 TCTTATTTGGGCATGGTTTCTGG + Intergenic
1120323812 14:83000061-83000083 TCTTATATGGGTGCAGTTTGTGG + Intergenic
1120544120 14:85789266-85789288 TCTTATCTAGGAATAGTTTGTGG - Intergenic
1120592568 14:86392955-86392977 TCTTATATGAATATGGTTTGTGG + Intergenic
1120755386 14:88238981-88239003 TCTTCAAAGGGCATGGTTGGTGG + Intronic
1121018751 14:90565903-90565925 TCTTATATGGGTGTGGTTCATGG + Intronic
1121036358 14:90707240-90707262 TCTTAGGTGGGCATGGTTTGTGG - Intronic
1121165568 14:91793649-91793671 TCTTATATAGGTGTGGTTCGTGG - Intronic
1121766604 14:96492850-96492872 TCTTATATGGGCATGGTTTGTGG + Intergenic
1121997993 14:98620319-98620341 TCTTATATGGACATGGTTTATGG - Intergenic
1124036556 15:26058280-26058302 TCTAATATAAGCATGGTTTGTGG - Intergenic
1124255228 15:28136046-28136068 TCTTTTATGGGTATGTTTTGTGG - Intronic
1124255390 15:28137590-28137612 TCTTCTATGGGTGTGGTTTGTGG - Intronic
1124461003 15:29891716-29891738 TCTTATATGGGCAGGGTTTGTGG - Intronic
1124568921 15:30842035-30842057 TCTTCTATGGGTGTGGTTTGTGG + Intergenic
1124569083 15:30843576-30843598 TCTTTTACGGGTATGTTTTGTGG + Intergenic
1124878141 15:33615539-33615561 TTATATATTGGCATTGTTTGAGG + Intronic
1125313606 15:38407609-38407631 TTTTACATGCGAATGGTTTGGGG - Intergenic
1125778036 15:42235900-42235922 TCTTCTATAGGCATTCTTTGAGG - Intronic
1125810477 15:42536090-42536112 TCTTATATTGGCATGGTTTGTGG + Intronic
1125981349 15:44004572-44004594 TCTTCTATGGGCATGGCTTATGG - Intronic
1126828224 15:52572196-52572218 TCTTATGTGGGAGTGGTTTGTGG - Intergenic
1126885920 15:53149944-53149966 TCTTACATGAACATGATTTGTGG - Intergenic
1126939348 15:53749380-53749402 TCTTATATGGGCATAATTTATGG - Intronic
1127025441 15:54800156-54800178 TCTTATATAGGCAAGGTTCGTGG - Intergenic
1127447136 15:59075028-59075050 TCTTATATGGGCACAGTTCTTGG + Intronic
1127724884 15:61739913-61739935 ACCTATATGAGCATGGTTTATGG + Intergenic
1127948574 15:63781500-63781522 TCTTATATGGGTGTGCTTTGTGG - Intronic
1128969476 15:72094894-72094916 TCTTATATGGTCATGATTTTTGG - Intronic
1129049166 15:72763926-72763948 TCTTATGTGGGAATGATCTGTGG - Intronic
1129126446 15:73445763-73445785 TCTTCTATGGGCATGGTTTGTGG + Intronic
1129326232 15:74801611-74801633 TCTTGGATGGGTAGGGTTTGAGG + Intronic
1129948813 15:79567318-79567340 TCTTAGATGGGCATGGCTTGTGG - Intergenic
1130129840 15:81130918-81130940 TCTTATATGCCCATGGTTCATGG + Intronic
1130290444 15:82594942-82594964 TCTTACATGGGAATGGTTTGTGG + Intronic
1130301772 15:82685111-82685133 TCATGTCTGAGCATGGTTTGTGG + Intronic
1130408158 15:83621493-83621515 TCTTATATAGGCATTGTTTGTGG + Intergenic
1131626022 15:94121858-94121880 TCTTCTATGGGCATGGCTTGTGG - Intergenic
1131878860 15:96841000-96841022 TCTTATATGGGCATGGCTTATGG - Intergenic
1132032414 15:98449623-98449645 ACTTACACGGGCATGGTTTGTGG + Intronic
1132295011 15:100728481-100728503 TCTCCTATGGTCATGTTTTGCGG + Intergenic
1132475414 16:133974-133996 TCTTATGTGGACATGGTTCTTGG + Intronic
1132538080 16:493413-493435 GCTTATTTGGTCATGCTTTGTGG + Intronic
1133512993 16:6478804-6478826 TCTTATATGGGCACAGTTTTTGG + Intronic
1134272994 16:12750528-12750550 CCTTAAATGGACATGGTTTGTGG + Intronic
1136025586 16:27466388-27466410 TCTTATGTGGGCATGGTTTGTGG - Intronic
1136501538 16:30672466-30672488 TCTTACATGGGCACTGTTTGTGG + Intergenic
1137416158 16:48282620-48282642 TCTTATATGGGTGCAGTTTGTGG - Intronic
1137740374 16:50765350-50765372 TCTTATATGGGTGTGGTTTGTGG - Intronic
1138518375 16:57553027-57553049 TCTTATATGGGCGCAGTTTGTGG + Intronic
1138836012 16:60435516-60435538 TCTTATATGGGCATGTTTCCTGG - Intergenic
1139014005 16:62668027-62668049 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1139125900 16:64077031-64077053 TCTTATATGGGCACAGTTTGTGG - Intergenic
1139990964 16:70938956-70938978 TCTGATATGGGCATCTTTGGGGG - Intronic
1140574681 16:76152798-76152820 TCTTATATGGGCATAGTACATGG + Intergenic
1141292323 16:82730490-82730512 TCTTGTATGGGCATGGTTTGTGG + Intronic
1141304465 16:82848598-82848620 TCTTATATGGGCACAGTTTGTGG - Intronic
1141857029 16:86690088-86690110 TCTTATAGGGGCATGGTTCATGG + Intergenic
1142734457 17:1887211-1887233 TCTTATATGGGTGTAGTTGGTGG + Intronic
1142922732 17:3205213-3205235 TCTTATATGGGCATGATTTGTGG - Intergenic
1143184949 17:5004449-5004471 TCTTACAGGGTCATGGTCTGAGG - Intronic
1144265661 17:13566296-13566318 TCTTCTATGGGCGTGGTTTGAGG - Intronic
1144324461 17:14165447-14165469 TCTTTTATGGGCACGGCTTATGG - Intronic
1144895738 17:18530518-18530540 TCTTATGTGAACATAGTTTGAGG - Intergenic
1145136479 17:20413714-20413736 TCTTATGTGAGCATAGTTTGAGG + Intergenic
1145726862 17:27137169-27137191 TGTGATGTGGGAATGGTTTGTGG - Intergenic
1146042985 17:29474624-29474646 TCTTATATGGGCACAGTTCATGG + Intronic
1147027947 17:37604937-37604959 TCTTATACGAGCTGGGTTTGTGG + Intronic
1148696215 17:49560600-49560622 TCTTATATGGGCATGGTTTGTGG - Intergenic
1148803839 17:50253423-50253445 TCTTCTATGGGCATGGTTCATGG + Intergenic
1149177182 17:53886717-53886739 TTTTATATGGGCCTGGTTCATGG + Intergenic
1149326054 17:55530829-55530851 TCTTATTTGGGAATTGTCTGCGG + Intergenic
1149725983 17:58895150-58895172 TCTTATATGGGTGCAGTTTGTGG - Intronic
1149972050 17:61228656-61228678 TTTTACATGGGCATAGCTTGAGG - Intronic
1150947972 17:69767772-69767794 TCTTAGAGGGGCACAGTTTGTGG - Intergenic
1151027414 17:70694865-70694887 TCTTACATGGGTAGGGTTTGTGG - Intergenic
1151410744 17:73926541-73926563 TCTTTTATGGGCACAGTTTGTGG - Intergenic
1151859044 17:76745607-76745629 CCTTATATGGATCTGGTTTGTGG - Intronic
1152978963 18:254778-254800 TCTTAGATGGGCACAGTTTGTGG - Intronic
1153175426 18:2366907-2366929 TGTCATATGGGTATGGTTTGTGG - Intergenic
1153270650 18:3317957-3317979 TATTATATGGGTGTGGTTTGTGG + Intergenic
1153292810 18:3518301-3518323 TCTTATATGGGCACGGTTCATGG + Intronic
1153492887 18:5667801-5667823 TCTGTTATGGGCATGGCTCGTGG + Intergenic
1153569886 18:6459622-6459644 TTTTATAAGGGCACGGTTTATGG - Intergenic
1153696494 18:7648196-7648218 TCTTATATGGGCACGGTTCATGG - Intronic
1154096649 18:11422864-11422886 TCTCATATGGGCACGGTTAATGG + Intergenic
1154341642 18:13507681-13507703 TCTTATATGGGTATGGTTTGTGG - Intronic
1154436465 18:14346324-14346346 CCTTATATATGCATGTTTTGAGG + Intergenic
1155266176 18:24096021-24096043 TCTTATGTGGGCATGGTTTGTGG + Intronic
1155741197 18:29290327-29290349 TCTTATATGGGCAAGGTTTCTGG - Intergenic
1155809958 18:30219821-30219843 TCTTATATGGGCACAGTTTGTGG + Intergenic
1156110625 18:33722035-33722057 TCTTATGAGGGCATGGTTTGTGG - Intronic
1156131013 18:33974537-33974559 TCTTATATGGGAGAAGTTTGTGG + Intronic
1156785631 18:40910497-40910519 TCTTATGTGGGCGTGGTTCATGG + Intergenic
1156875971 18:42011965-42011987 TCCTATATGGGTATGCTTTGTGG + Intronic
1157223723 18:45844776-45844798 CCTTGTATGGGGATGCTTTGGGG + Intergenic
1157371853 18:47120895-47120917 CTTAACATGGGCATGGTTTGTGG + Intronic
1158068526 18:53442421-53442443 TCTTATATGGGTGCAGTTTGTGG - Intronic
1158582078 18:58692326-58692348 TCTTATAGTGGCATAATTTGTGG - Intronic
1158776475 18:60588096-60588118 CCTTATATGAGTATGGTTGGTGG - Intergenic
1159332133 18:67009447-67009469 TCTTATATGGGTGTGGTTTGTGG + Intergenic
1159514503 18:69440200-69440222 TCTTATATGGGCATGGTTTATGG + Intronic
1159695119 18:71547317-71547339 TCTTACATGGGCGTGGTTTGTGG + Intergenic
1159700536 18:71621162-71621184 TGTTACATGGGTGTGGTTTGTGG + Intergenic
1159906275 18:74095560-74095582 TCTTACATGGGCACTGTCTGAGG + Intronic
1160117408 18:76093661-76093683 TCTTATATGGGCATGGTTTGTGG + Intergenic
1160166218 18:76514765-76514787 TCCTATATGGGCGTGGTTTGTGG + Intergenic
1160347896 18:78149937-78149959 TCTTATACGAGCATGCTTTGTGG + Intergenic
1160520304 18:79504470-79504492 TCTTAGATGGGCACAGTTCGTGG + Intronic
1160552051 18:79700024-79700046 TCTTATGTGGGTGTGGTTCGTGG - Intronic
1163135318 19:15306778-15306800 TCTTAGATGGACATGGTTTGTGG + Intronic
1163466922 19:17473427-17473449 TGTTGAATGGGCATGCTTTGAGG + Intronic
1166021369 19:40033085-40033107 TCTTTTATGGGCAGGATTTGTGG + Exonic
1166024880 19:40073266-40073288 TCTTTTATGGGCAGAATTTGTGG + Exonic
1166392181 19:42414817-42414839 TCTTACGTGGACATGGTTGGTGG - Intronic
1166776036 19:45313334-45313356 TTTTATATGGGCAAGGTCGGTGG - Intronic
1167332210 19:48863112-48863134 GCTTCTATGGGAATGGGTTGAGG - Intronic
1167397590 19:49241389-49241411 TTTTATATGGGCATAGTTTGTGG + Intergenic
925360084 2:3272603-3272625 TCTTACATGGGCATGGTTCGTGG + Intronic
925871453 2:8275058-8275080 TCTTATATGGGCCTGGTTTGTGG + Intergenic
925954271 2:8946731-8946753 TCTTATGTGGGCACAGTTTGTGG - Intronic
926057467 2:9782764-9782786 TCTTATATGGGCACGATTCATGG - Intergenic
926722283 2:15969950-15969972 CCTCATACGGGCATGGCTTGTGG + Intergenic
926834842 2:17007067-17007089 TCTTATATAGGCATGGTTTCTGG - Intergenic
927299057 2:21489616-21489638 TCTTTTATGGGTGAGGTTTGCGG + Intergenic
927731323 2:25474913-25474935 TCTTATGTGGGCATGGTTTGTGG - Intronic
928264021 2:29794742-29794764 CCTTATAGGGGCATGGTTTGTGG + Intronic
928792075 2:34969494-34969516 TCTTATATGGGCATGGTTTGTGG + Intergenic
929369994 2:41211486-41211508 TCTAATCTGGGCTTGGTTGGTGG + Intergenic
929529771 2:42741738-42741760 TCTTATATGGGCATGGCTTGTGG + Intronic
930322165 2:49869300-49869322 TCTTATAAGGGCACACTTTGTGG + Intergenic
930492039 2:52086294-52086316 TCTAATATGGGTACAGTTTGTGG + Intergenic
930507146 2:52297638-52297660 TCTTGTATGGATGTGGTTTGTGG - Intergenic
930583135 2:53236572-53236594 TCATATGTGGGTGTGGTTTGTGG - Intergenic
930831332 2:55746724-55746746 TCTTACATGGGCATGATTTATGG - Intergenic
930949574 2:57123098-57123120 TCTCAGAAGGGCATGGTTCGTGG + Intergenic
931279617 2:60777855-60777877 TCTTATATGGGCTCAGTTTGTGG + Intronic
931327213 2:61239053-61239075 TCTTATATGGGTGTAGTTCGTGG - Intronic
931407941 2:61998913-61998935 TCTTCTATGGGCATGTTTCATGG + Intronic
931960957 2:67482364-67482386 TCTTATATGAGCATTGTTCATGG - Intergenic
932116756 2:69057530-69057552 TCTTACATGTGTGTGGTTTGTGG - Intronic
932469958 2:71948321-71948343 TTTTCTATGGGCATGGTTCATGG + Intergenic
933035742 2:77395185-77395207 TCTTATATTGGCTTCCTTTGTGG - Intronic
933626734 2:84609587-84609609 TCTTATATAAGCATGGTTCATGG + Intronic
933896809 2:86818576-86818598 TCATAAATGGGCATGGTTCATGG - Intronic
933906250 2:86896465-86896487 TCTTATATGGGTACAGTTCGTGG - Intergenic
934489529 2:94751174-94751196 CCTTATATGTGCATGTTTTGAGG - Intergenic
934869664 2:97851710-97851732 TCTTATGTGGGCATAATTTGTGG - Intronic
934881113 2:97980104-97980126 TGTCATATGGGTGTGGTTTGTGG + Intronic
935036664 2:99383287-99383309 TCTTATAGGGGTGTGGTTTGTGG - Intronic
935616381 2:105087168-105087190 TTCTATATGTGGATGGTTTGTGG + Intronic
935990391 2:108713969-108713991 TCTTGTATGAGCATGGCTTGCGG + Intergenic
936079848 2:109424678-109424700 TCTTATGTGGGCATGGTCCATGG - Intronic
936365916 2:111855217-111855239 TCTTATATGGGTACAGTTCGTGG + Intronic
936409544 2:112244751-112244773 TCTTATGTGGGCATGGTTCATGG - Intronic
936726564 2:115324987-115325009 TCTTATGTGGTCATGGTTCATGG + Intronic
936920170 2:117680467-117680489 TCTTATATGGGTATGGTTGGAGG - Intergenic
937124009 2:119461807-119461829 TCTGATATCTGCATGGTATGTGG - Intronic
937174027 2:119908491-119908513 TCTTATATGGGTGTGGTTTGTGG - Intronic
937796666 2:126030620-126030642 TCCTATATGGATATGGTTTGTGG + Intergenic
937979285 2:127604825-127604847 TCTTATATGGGTGCAGTTTGTGG + Intronic
938022554 2:127917933-127917955 TCTTATATGGGCACAGTTGGTGG + Intergenic
938174189 2:129109248-129109270 CCTTATATGGGCATGATTTGTGG + Intergenic
938423884 2:131167987-131168009 TCTTATATGGGTGTGGTTTGTGG - Intronic
938562556 2:132487157-132487179 TCTTATATGGGTATGGTTTGTGG + Intronic
938621305 2:133057099-133057121 TCTTATATGGGCACGATTTGTGG - Intronic
938876957 2:135541638-135541660 TCTTATATGGGTGTGATTTGTGG + Intronic
938987237 2:136589290-136589312 TCTCATATAGGCATGGTTTGTGG + Intergenic
939274311 2:139980471-139980493 TCATATGTGGGTGTGGTTTGAGG + Intergenic
939486577 2:142820004-142820026 TTTCATATGGGTATGGTTTGTGG + Intergenic
939509138 2:143085101-143085123 AGTTATACGGGCATGGTTTGTGG - Intergenic
939556194 2:143676656-143676678 TCTCATATGGGCGCAGTTTGTGG + Intronic
939722739 2:145675200-145675222 TCTTAAATGGGCACGGTTTGTGG + Intergenic
939867783 2:147493638-147493660 TCTTATGTGGGCACGGTTTGTGG - Intergenic
939933673 2:148261990-148262012 TTTTATATGGACATGTGTTGTGG + Intronic
940698671 2:157014127-157014149 ACTCAAATGGTCATGGTTTGAGG + Intergenic
940756653 2:157690574-157690596 CCTTAGATGGGCATGGTTCATGG + Intergenic
941016426 2:160362565-160362587 TCCTATATGGGAATGGTTTGTGG + Intronic
941077465 2:161022171-161022193 TCTTTTATGGGCATGGTGTGTGG - Intergenic
941433877 2:165444329-165444351 TCTTCCATGGGCATGGTTTGTGG - Intergenic
941733020 2:168939947-168939969 TCTTATATTGGCGTGGTTCGTGG - Intronic
941801874 2:169668746-169668768 TCTTATATGGGTACAGTTCGTGG + Intronic
942050744 2:172138442-172138464 GTTTATATGGGCATGGTTCTTGG - Intergenic
942787374 2:179715043-179715065 ACTTGGATGTGCATGGTTTGGGG - Intronic
942833193 2:180261533-180261555 TCTTATATGGGTGTGGTTCTTGG + Intergenic
942876851 2:180810840-180810862 TCTTATATGGGCAAGGTTTGTGG - Intergenic
943616568 2:190099451-190099473 TCTTATATGGACACGGTTCAAGG + Intronic
943695112 2:190918933-190918955 TCTTATATGGACATGGCTTGTGG + Intronic
943851290 2:192725889-192725911 CTTTATATGGGCGTGGTTTGTGG + Intergenic
943935446 2:193909566-193909588 TTTTATATGGGCACAGATTGTGG - Intergenic
943978021 2:194508833-194508855 TCTTATATGAGTGTGGTTTGTGG - Intergenic
943985812 2:194616672-194616694 TCTTGTATGGGCCTGATTTGTGG + Intergenic
944255705 2:197621618-197621640 TTTTATATGGGCATGGTTCCCGG - Intronic
944273949 2:197814388-197814410 TATTATATGGGCATAGTTCATGG - Intronic
944623034 2:201538629-201538651 TCTTAGATGGGTGTGGTTTGTGG - Intronic
944750074 2:202699990-202700012 TCTTATATAGGCATGGTTCATGG - Intronic
945346116 2:208718777-208718799 TCTTATATGGGCACAGTTCATGG + Intronic
945830211 2:214775435-214775457 TGTTACATGGCCAGGGTTTGTGG + Intronic
946086333 2:217176952-217176974 TCCTATATGGGTATGGTTCATGG + Intergenic
946133109 2:217622842-217622864 TCTGATATGGGAATGGTTTTTGG - Intronic
946524207 2:220500630-220500652 TCTTATATTGGCACAGTTTGGGG - Intergenic
946853209 2:223928044-223928066 TCTTATGTGGGCACAGTTTGTGG + Intronic
947020737 2:225672878-225672900 TCTTATATGGGCATGGTTCGTGG + Intergenic
947234603 2:227926943-227926965 TTTTATATGGGCATGATTCATGG - Intergenic
947256307 2:228168541-228168563 TCTTGTATAGCCATGGTGTGTGG - Intronic
947554022 2:231073172-231073194 TTTTATATGGGTGTGGTTCGTGG + Intronic
948107134 2:235423611-235423633 TCTTATATGGGCATGGTTCATGG - Intergenic
948316126 2:237029948-237029970 TCTTATATAGGCAGGGCCTGGGG + Intergenic
948845300 2:240680213-240680235 TCTGCAGTGGGCATGGTTTGGGG - Intronic
948955038 2:241282723-241282745 CCTTGTATGAGCGTGGTTTGTGG - Intronic
1169322206 20:4642506-4642528 TCTTATGTGGGTATGGTTTGTGG - Intergenic
1169750797 20:8991349-8991371 TCTTTTATGGGCATGGGTCTTGG + Intergenic
1170247075 20:14233103-14233125 TCTTATATGGGTGTGGTTCATGG + Intronic
1171145931 20:22782676-22782698 TCTTATATGGGCACGGTTCATGG - Intergenic
1171205490 20:23276092-23276114 TCTTATATGGGTGCAGTTTGTGG - Intergenic
1171236695 20:23532856-23532878 ACTTATATGGTCATGGTTCTTGG + Intergenic
1171313163 20:24162417-24162439 TCTCACATGGGTGTGGTTTGTGG - Intergenic
1171879471 20:30607121-30607143 CCTTATATGTGCATGTCTTGAGG - Intergenic
1172257763 20:33534814-33534836 TCTTATATGGGCACAGTTTGTGG + Intronic
1173707368 20:45121794-45121816 TCTTATGTGGGCACAGTTTATGG + Intergenic
1173910714 20:46667964-46667986 TCTTATATGGGCACAGTTCATGG - Intronic
1173942087 20:46920033-46920055 TCTTATATGGGCACAGTTTGTGG + Intronic
1174652551 20:52140062-52140084 TCTTATATGGACATGGTTCATGG - Intronic
1174692545 20:52521973-52521995 CCTTATATGGACATGGTTTGTGG + Intergenic
1174834408 20:53842640-53842662 TCTTATATGGGTATGGTTCATGG - Intergenic
1174991396 20:55514302-55514324 TCTTCTGTGAACATGGTTTGTGG + Intergenic
1175025594 20:55899084-55899106 TCTTATATGGGTACAGTTGGTGG + Intergenic
1175168030 20:57059944-57059966 TCTTATACGGGCACAGTTCGTGG + Intergenic
1176411706 21:6452679-6452701 TCTTCTCTGGGCTTAGTTTGAGG + Intergenic
1176840578 21:13839328-13839350 CCTTATATGTGCATGTTTTGAGG - Intergenic
1177335717 21:19723465-19723487 GCTTATATGGGCATGGTTTGTGG + Intergenic
1177654639 21:24002184-24002206 TCTTATATGGGCACAGTTTGTGG - Intergenic
1178070661 21:28962484-28962506 TCTTATATGGCAATGGTTTGTGG - Intronic
1178100546 21:29264129-29264151 TCTTATATGGGCGGGGTTTGTGG + Intronic
1178177095 21:30114989-30115011 TCTTATATGGGCATGGTTTGTGG + Intergenic
1179465875 21:41572290-41572312 CCTTATGTGGGCATGGTGTCAGG + Intergenic
1179687200 21:43061001-43061023 TCTTCTCTGGGCTTAGTTTGAGG + Intronic
1180113274 21:45676577-45676599 TCTTATATGGGCAAAGTTCATGG - Intronic
1180848870 22:19000846-19000868 TCTTATATGGGCACAGTTCATGG + Intergenic
1180878980 22:19190390-19190412 TCTTATAGGGGCATGGTTTGTGG + Intronic
1180932590 22:19603296-19603318 TCTTATACGGGCATGGTTCCGGG + Intergenic
1181664064 22:24378758-24378780 TCTTATATGGGCACAGTTCATGG + Intronic
1182734596 22:32523199-32523221 TCTTATATGGGTGTGGTTCATGG - Intronic
1183008450 22:34924322-34924344 TATTATATGGGCATGGTTCACGG + Intergenic
1183764547 22:39859647-39859669 TCTTCTACAGCCATGGTTTGTGG + Intronic
1184083008 22:42238783-42238805 TCTTATATGGGAGTGCTTTGTGG + Intronic
1184575247 22:45358840-45358862 TCTTATATGGGAGTGGTTCATGG + Intronic
1185084321 22:48730716-48730738 TCTTACACGGGCATGGTTTGTGG - Intronic
949317817 3:2776174-2776196 TCTTATATTGGCAAGGTCTGGGG + Intronic
949438374 3:4053276-4053298 TCTTTTATGGACATGGTTCGTGG + Intronic
949456983 3:4249519-4249541 TCTTATATGGACGTGATTTGTGG - Intronic
949626410 3:5871737-5871759 TCTTACATGGGCACGGTTTGTGG - Intergenic
949813554 3:8034188-8034210 CTTTATATGGGCATGGTTTGTGG + Intergenic
949846861 3:8380404-8380426 ACTTCTATGGGCATGGGTTGAGG - Intergenic
950112654 3:10429508-10429530 TCTGATATGGGCATGGTTTGTGG - Intronic
950118509 3:10466655-10466677 TCATCTGTTGGCATGGTTTGGGG - Intronic
950246391 3:11423256-11423278 TCTTATATAGGTACAGTTTGTGG + Intronic
950315015 3:11994356-11994378 TCTTATATGAGTGCGGTTTGTGG + Intergenic
951313230 3:21156112-21156134 TCCTATATGGAAGTGGTTTGTGG + Intergenic
951422178 3:22499810-22499832 TCTTATATGGGCATGGTTTATGG - Intergenic
951741373 3:25928102-25928124 TTATATGTGGGCATGGTTTGTGG + Intergenic
952003678 3:28815901-28815923 CATATTATGGGCATGGTTTGTGG + Intergenic
952639258 3:35572409-35572431 TCTTATATGAGCACTGTTTGTGG - Intergenic
952661465 3:35854697-35854719 TATTATGTGGGCATAGTTAGTGG + Intergenic
952806039 3:37353121-37353143 TCTTATATGGGCATGGTTTGTGG + Intronic
954871718 3:53772421-53772443 TCTTTTGTGGGTATGTTTTGGGG - Intronic
955211150 3:56942428-56942450 TCTTATATGAGGATGGTTCGTGG - Intronic
955290336 3:57686690-57686712 TCTTATATGGGCATGGTTTGTGG - Intronic
955426560 3:58796929-58796951 TCTTATATGGGCATGGTTCCTGG - Intronic
955678306 3:61472719-61472741 CCTTATATGGGCATGATTTGTGG + Intergenic
955831021 3:63004188-63004210 TTTTATAAGAGCCTGGTTTGTGG + Intergenic
955969796 3:64426994-64427016 TCATATATGGGCAGAGTTTGTGG - Intronic
956063558 3:65373343-65373365 TCTTATGTGGGTATGGTTTGTGG + Intronic
956098223 3:65739783-65739805 TCTTATATGGGTATAGTTTGTGG + Intronic
956960746 3:74397430-74397452 TCTTATATGAGCACAGTTTGTGG - Intronic
957499733 3:81038954-81038976 TCTAAGATGGGTGTGGTTTGTGG + Intergenic
957627060 3:82666781-82666803 TCTTATATGGGCAAAGTTCCTGG + Intergenic
957645245 3:82913910-82913932 TCCTATATGGGTTTGGTTTGTGG - Intergenic
957782914 3:84842777-84842799 TCTTACATGGGTGTGGTTTGTGG - Intergenic
957863734 3:85994795-85994817 TCCTATATGAGCATGGTTTGTGG + Intronic
957928773 3:86849973-86849995 TCTTGTATGGTGGTGGTTTGTGG - Intergenic
957955752 3:87184988-87185010 TCTTATATGGGTGTAGTTTGTGG + Intergenic
958698758 3:97561010-97561032 TCTTACATGGGCATTGTTCATGG - Intronic
959039106 3:101400579-101400601 TCTTATGCATGCATGGTTTGTGG - Intronic
959238595 3:103757770-103757792 TCTTATGTGGGTGTTGTTTGTGG + Intergenic
959721704 3:109498103-109498125 TCTCATATGGGCCTGGTTCATGG + Intergenic
959773079 3:110123316-110123338 TCTTATATGAGCATAATTTATGG - Intergenic
959821219 3:110737541-110737563 TCTCATATGGAGATGGTTCGTGG + Intergenic
959923921 3:111900564-111900586 TCTTATATGGGCATGGTTTGTGG + Intronic
960097992 3:113706634-113706656 TCTTATATGGGCACAATTTGTGG + Intergenic
960154627 3:114286261-114286283 TCTTATATGGGCCTGGTTTGTGG + Intronic
960179853 3:114562867-114562889 TCTTATATGGGTGTGGTTTGTGG + Intronic
960229934 3:115213875-115213897 TCTGATATGGACATAATTTGTGG - Intergenic
960442057 3:117701031-117701053 TGTTATATGGATATAGTTTGTGG + Intergenic
960476386 3:118134543-118134565 TCTTACATGGGTGAGGTTTGTGG - Intergenic
960648091 3:119912270-119912292 TCTTATATTGTTGTGGTTTGTGG + Intronic
961092142 3:124122654-124122676 TTTTATATGGGCATGGTTTGTGG - Intronic
961725423 3:128925187-128925209 GGTTGTATGGGCATGGTTTGGGG + Intronic
962033470 3:131626018-131626040 TCTTATAGGGACACAGTTTGTGG - Intronic
962461396 3:135616842-135616864 TCTTATGTGGGCATGGTTCATGG + Intergenic
962650250 3:137481141-137481163 TCTAATAATGGCAGGGTTTGTGG + Intergenic
962836861 3:139197212-139197234 TCCTATATGGGCATGGTTCATGG + Intronic
963054018 3:141169165-141169187 TCTTATATGGGTGTGGTTCATGG - Intergenic
963081392 3:141397778-141397800 TCTTATATGGGCGTGGTTCATGG + Intronic
963183845 3:142391003-142391025 TCTCAAATGGGCATGGTTGATGG + Intronic
963195217 3:142520154-142520176 TCTTATATGGGCACAGTTTGTGG - Intronic
963243018 3:143029482-143029504 TCTTATATGACCATAGTTTGTGG - Intronic
963283932 3:143414605-143414627 TCTTTTATGGGCAATGTCTGTGG - Intronic
963325789 3:143861481-143861503 ACTTCTATGGCCATGGTTTGGGG - Intergenic
963510702 3:146244594-146244616 TCTTATATAGGCATGGTTCATGG - Intronic
963608806 3:147439364-147439386 TCTTGTGTGGGCATGGTTTGTGG + Intronic
963773265 3:149411246-149411268 TCTTATATGGGCATGGTTTGTGG + Intergenic
963946524 3:151151675-151151697 TCTTATATGGGAATGGTTCGTGG + Intronic
964398831 3:156277213-156277235 TCTTATATGGGTACAGATTGTGG + Intronic
964596970 3:158443999-158444021 CCCTATATGGGCCTGGTTTGTGG + Intronic
964617009 3:158677156-158677178 TCTTATATGGGCAGGTTTCATGG - Intronic
964813563 3:160692476-160692498 TCTTATATGGACAGGGTTCAAGG - Intergenic
964930176 3:162009934-162009956 TCTTATATGGACATGGTTTGTGG + Intergenic
965224176 3:165966599-165966621 TCTTATGTGAGCATGGTTTGTGG - Intergenic
965831267 3:172792106-172792128 TCTCATATGGGCATTGTTAGTGG + Intronic
965918630 3:173883360-173883382 TCTTATATGGGTGTGGTTTGTGG + Intronic
966214336 3:177486490-177486512 TCTTATATGGGCACAGTTCATGG + Intergenic
966503024 3:180667564-180667586 TCTTAGAGAGGCACGGTTTGTGG - Intronic
966633238 3:182102437-182102459 TCTTATCTGGGCTTGGTAGGTGG + Intergenic
966663676 3:182446208-182446230 TCTTATACAAGCATGGTTCGTGG - Intergenic
967400386 3:189054301-189054323 TTTTATAAGACCATGGTTTGTGG + Intronic
967400403 3:189054502-189054524 TTTTATAAGAGCATGGTTTGTGG - Intronic
967491840 3:190101057-190101079 TCTTATATGGGCATGGTTTGTGG - Intronic
967545273 3:190718373-190718395 TCTTATATGGGTGTGGTTCATGG + Intergenic
967571699 3:191036860-191036882 TCTTATATGAGCATGGTTCTTGG - Intergenic
967710797 3:192705561-192705583 TCTTATGTGGGCATGGCTTGTGG + Intronic
968153586 3:196359252-196359274 TCTTGTGTGGGCGTGGTTTGTGG - Intronic
970479235 4:16456906-16456928 TCTTATATGAGCACAGTTTCTGG + Intergenic
970578792 4:17454135-17454157 TCTTATATGGGCATGGTTAGTGG - Intergenic
970605391 4:17676327-17676349 TCTTCTACGGGCATGGTTTGTGG + Intronic
970629793 4:17927720-17927742 TCTCATATGGGAGTGGTTCGTGG + Intronic
970945209 4:21682842-21682864 TCTCATATAGGTATGGTTGGTGG + Intronic
971016746 4:22496871-22496893 TCTGTCATGGGCATGGTATGGGG - Intronic
971295557 4:25386521-25386543 TTTTATATGGCCATGGTTTGTGG + Intronic
971477907 4:27089583-27089605 TCATACATTGGCATGGTTTTGGG + Intergenic
971588372 4:28433932-28433954 CCTTCTATGGGTGTGGTTTGTGG + Intergenic
971679865 4:29683933-29683955 TATTATATGGGCATGGTTTTTGG - Intergenic
971709065 4:30088079-30088101 TCTCATATGGGCATGGTTTGTGG + Intergenic
971825202 4:31612366-31612388 ACTTATATAAGCAAGGTTTGGGG - Intergenic
971830828 4:31692530-31692552 TTTTATGTGGGCATAGTTTTTGG - Intergenic
971868554 4:32205636-32205658 TATTAATTGGGTATGGTTTGTGG - Intergenic
972189358 4:36571240-36571262 TCTTACATGGGTGTGGTTCGTGG + Intergenic
972338639 4:38131023-38131045 CCTCATATTGCCATGGTTTGGGG + Intronic
972383720 4:38543420-38543442 TCTTATATGAGCATGGTTGGTGG + Intergenic
973128159 4:46614818-46614840 TCTTATATGGGCCCAGTTTGTGG - Intergenic
973165184 4:47068656-47068678 TCTTATATGGGCATGATTCATGG + Intronic
973235297 4:47896087-47896109 TCTAATAGAGGCATGGTTTGTGG + Intronic
974212066 4:58791042-58791064 TCTTATATGAGCATGGCTTATGG - Intergenic
974316227 4:60284711-60284733 TCTTATATGGGCACAGTTTGTGG - Intergenic
974423336 4:61707153-61707175 TCTTATATAGGCATGGTTCGTGG + Intronic
974997018 4:69174152-69174174 TCTTATATGGGCGTGGATTGTGG - Intronic
975008033 4:69314634-69314656 TCTTATATGGGCGTGGATTGTGG + Intronic
975009989 4:69339115-69339137 TCTTATATGGGCGTGGATTATGG - Intronic
975124923 4:70771038-70771060 TCTTATATGGGCGTAGTTCATGG + Intronic
975322996 4:73029243-73029265 CCTTATATGGGCATGGTTCATGG - Intergenic
975478282 4:74847931-74847953 TCTTATATAGGCATGATTCATGG - Intergenic
975567884 4:75779095-75779117 TCTTATATGGGCACTGTTTGTGG - Intronic
975686556 4:76921594-76921616 TCGTATATGGGTGTGGCTTGTGG + Intergenic
975762056 4:77630302-77630324 TCTTATATGGGTACAGTTTGTGG + Intergenic
975880103 4:78895007-78895029 TCTTATATGGGCTCAGTTTGTGG + Intronic
976058550 4:81098732-81098754 TCTTATATGGCTGCGGTTTGTGG + Intronic
976154457 4:82127602-82127624 TCTTATATGGGCTAGGTTCCTGG - Intergenic
976465460 4:85363207-85363229 TCTTGTATGGGTATGGTTTCTGG + Intergenic
976513102 4:85933039-85933061 TCTTAAGTTGGCATGGTTTTAGG - Intronic
976835306 4:89365766-89365788 CTTCATATGGACATGGTTTGTGG - Intergenic
976885359 4:89976769-89976791 TCTTATATGGGCATGGTTAATGG + Intergenic
977072087 4:92403927-92403949 TCTTATGTGGGCATAGTTCATGG + Intronic
977356059 4:95948320-95948342 TCTTATATGGGCACAGTTTGTGG + Intergenic
977368812 4:96107971-96107993 TCTCATATGGGCACAGTTTGTGG - Intergenic
977401130 4:96534047-96534069 TTTTATATGGGCATTGTTCACGG - Intergenic
977539320 4:98297583-98297605 TCATACATGGGCATGGTTCACGG - Intronic
977715132 4:100173612-100173634 TCTCATATGGGTGTGGTTCGTGG + Intergenic
977981271 4:103325314-103325336 TCTTATATGGGCATGGTTTGTGG + Intergenic
978181309 4:105799617-105799639 TCTTAAGTGGGCATGGTTCGTGG + Intronic
978249424 4:106612240-106612262 TCTTATATGGGAGTGGTTTGTGG + Intergenic
979374358 4:119928060-119928082 TCTTATATGGGCATGGTTCATGG - Intergenic
979619323 4:122780803-122780825 TCTTATATGGACATGGTTCATGG + Intergenic
979626001 4:122846178-122846200 TCTTATATGGGTGTAGTTTGTGG + Intronic
979648626 4:123104289-123104311 TCTTACATGGGTGTGGTTTATGG - Intronic
979659088 4:123231906-123231928 TCTTATATGGGCATGGTTTGTGG + Intronic
979811560 4:125042608-125042630 TCTTACAAGGGCATGGTTCGTGG - Intergenic
979933641 4:126664669-126664691 TCTTATATGGGCTCAATTTGTGG - Intergenic
980157773 4:129127567-129127589 TCATATATGTGTCTGGTTTGGGG - Intergenic
980433685 4:132740133-132740155 TCTTATATGGGCATGATGTTTGG - Intergenic
980529465 4:134033225-134033247 TCTTATATGGGTGTGGTTTGTGG - Intergenic
980549720 4:134318853-134318875 TCTTATATGGGCATAGTTTGTGG + Intergenic
980952889 4:139399082-139399104 TGTTATATGGGCACAGTTTGTGG + Intronic
981200635 4:141975389-141975411 TCTTATATGGACATAGTTTGTGG - Intergenic
981391931 4:144201189-144201211 TCTTATATAGGTACTGTTTGTGG + Intergenic
981464422 4:145051307-145051329 TATTATATGAGCATGGTTCATGG + Intronic
981493002 4:145361112-145361134 TCTTACATGGGTGTGGTTTGTGG - Intergenic
981683431 4:147426446-147426468 TCTTCTATGGGCACAGTTTGTGG - Intergenic
981764578 4:148233763-148233785 TCTTACGTGGTCATGGTTTGTGG + Intronic
981984784 4:150840575-150840597 TCTTAAATGGGTGTGGTTTGTGG + Intronic
982036182 4:151348396-151348418 TCTTATGTGGGCATGGTTTGTGG - Intergenic
982169975 4:152652049-152652071 TCTTCTGTGAGCATGGTTTCAGG + Intronic
982344650 4:154344122-154344144 TCTTTCATGGCCATGGTTTGTGG + Intronic
982439107 4:155414127-155414149 TCTTATATGGGCTCAGTGTGTGG + Intergenic
982575694 4:157107093-157107115 TCTTATGTGGGCATGATTTGTGG - Intronic
982833438 4:160091798-160091820 TCTTATAAGGGCAGGATTTGTGG + Intergenic
982876028 4:160651016-160651038 TCTTATATGGGTACAGTTTGTGG - Intergenic
982903108 4:161032074-161032096 TCTTATATAGGCACAGTTTGTGG + Intergenic
983058260 4:163125048-163125070 TATTATATGGGCATAGTTCATGG - Intronic
983086710 4:163454016-163454038 TCTTATACGGGCATGGTTTGTGG + Intergenic
983275917 4:165617277-165617299 TCTTATATGGGTGTGGTTCATGG - Intergenic
983300878 4:165923983-165924005 TCTTATATGGGCATGGTTCATGG - Intronic
983615803 4:169703051-169703073 TCTTCTATGGGCATGGTTCATGG + Intronic
983764421 4:171459958-171459980 TCTTATATGGACCTGGTTAATGG + Intergenic
983808595 4:172027437-172027459 TCTTACAAGGGCACAGTTTGTGG - Intronic
983963235 4:173779316-173779338 TCTACTATGGGTATGGTTTGTGG - Intergenic
983987415 4:174076349-174076371 TATTATAGGGGTGTGGTTTGTGG + Intergenic
984121362 4:175749127-175749149 TCTTATATGAGTATAGTTTATGG + Intronic
984246781 4:177284335-177284357 TCTTATATGTGCACAATTTGTGG - Intergenic
984258612 4:177417094-177417116 TCTTATATGTGCACAGTTGGTGG + Intergenic
984299355 4:177895098-177895120 TCTTATATGGGCACAATTTGTGG - Intronic
984326260 4:178255444-178255466 TCTTATATGGGCATAGTTCATGG + Intergenic
984403621 4:179299041-179299063 TATTATATTGCCATGTTTTGTGG + Intergenic
984637143 4:182123601-182123623 TCTTATATAGGCATGGCTCATGG + Intergenic
984685546 4:182664336-182664358 TCTTATGTGGGTGTGGTTTCTGG - Intronic
984822947 4:183899125-183899147 TCTTATATGGGCACACTTCGTGG - Intronic
984911953 4:184682067-184682089 TTTTATATGTGTAGGGTTTGTGG + Intronic
985481757 5:116282-116304 TCTTATATTGGCATGGTTCATGG + Intergenic
986020039 5:3793011-3793033 TTTTATAATGCCATGGTTTGGGG + Intergenic
986682200 5:10244173-10244195 TCTTATTTGGGCATGGCTTGTGG + Intronic
986738636 5:10686129-10686151 TCTTATATGGGCACGGTTCGTGG - Intronic
987279923 5:16402569-16402591 TCTTATATGGGCACCATTTATGG + Intergenic
987328940 5:16837973-16837995 TCTTGTATGGGTGTGGTTTGTGG - Intronic
987501938 5:18722795-18722817 TTTTATATGGCTGTGGTTTGTGG + Intergenic
987611749 5:20213287-20213309 TCTTATACGGGCACAGATTGTGG + Intronic
987726654 5:21709324-21709346 TCTTATATGGGCACAGTTCATGG - Intergenic
987750428 5:22031788-22031810 TCTAATATGGGCACAGTTTATGG + Intronic
987966324 5:24880584-24880606 TCTTATATGGGAGTGGTTTGTGG - Intergenic
987982406 5:25103205-25103227 TTTTATATTGGTTTGGTTTGTGG + Intergenic
988160427 5:27513207-27513229 TCTTATATGGGTACAGTTTGTGG - Intergenic
988174954 5:27710875-27710897 TCTTATATGGTCATGGTTCATGG - Intergenic
988260011 5:28874110-28874132 CCTTTTATGGGCCTGGTTTGTGG + Intergenic
988278702 5:29115497-29115519 TCTTATATGGGGGTGATTTGTGG + Intergenic
988431600 5:31125460-31125482 TCTTATACGGGCATGGTTCGTGG - Intergenic
988669778 5:33368912-33368934 TTTTATAGGGGCATGGTTTGTGG + Intergenic
988704412 5:33710297-33710319 TCTTATATGGCAATGGTTGGAGG - Intronic
988889109 5:35595267-35595289 TCTTATATGGGTGTGGTTTGCGG + Intergenic
989001096 5:36761596-36761618 TCTTATACAGGTATGGTTCGTGG + Intergenic
989375074 5:40752630-40752652 TCTCATATGGGCATGGTTCATGG + Intronic
989454604 5:41628473-41628495 TCTTCTATGGGCACTATTTGTGG + Intergenic
990677053 5:58198840-58198862 TCATATATGGGCACAGTTTGTGG + Intergenic
990697496 5:58436960-58436982 TCTTATATGGACGTGGTTCATGG + Intergenic
990788756 5:59453170-59453192 TCTTATATAGGCATGGCTTATGG - Intronic
990832646 5:59976903-59976925 TCTTACATGGGCATGGTTTGTGG - Intronic
990874583 5:60469742-60469764 TCCTATATGGGCATGGTTTGTGG - Intronic
990979388 5:61588145-61588167 TCTTATATGGGCAGGTTTCATGG - Intergenic
991191823 5:63883375-63883397 TCTTATATGGGCGCAGTTTGTGG + Intergenic
991394132 5:66185660-66185682 TCTTATATGGGCACGGTTTGTGG - Intergenic
991729792 5:69574475-69574497 TCTTATATGGGCGCAGTTTGTGG - Intronic
991806224 5:70429616-70429638 TCTTATATGGGCGCAGTTTGTGG - Intergenic
991865162 5:71053399-71053421 TCTTATATGGGCGCAGTTTGTGG + Intronic
992074548 5:73178957-73178979 TCTTATATGAGCAAGGTTGATGG - Intergenic
992362956 5:76061048-76061070 TCTTATATGGGCATAGTTTGTGG + Intergenic
992426645 5:76664337-76664359 AGTTCTATGGGCGTGGTTTGTGG + Intronic
992462770 5:76977546-76977568 TCTTCTATGGGCACAGTTTGTGG - Intronic
992538123 5:77732770-77732792 TCTTATATAGGCACAGTTTGTGG - Intronic
992598396 5:78369438-78369460 AGTGTTATGGGCATGGTTTGTGG + Intronic
992781487 5:80132139-80132161 TATTATTTGCTCATGGTTTGGGG - Intronic
992835941 5:80641498-80641520 TCTTAAAAGGGCATGATTTATGG - Intronic
992918353 5:81483099-81483121 TCTTGTATGGGCACGGTTTGTGG + Intronic
993082121 5:83314742-83314764 TATTTTATGGGCATGGTTTGTGG - Intronic
993124338 5:83814090-83814112 TCTTATATGGGCACTGTTTGTGG + Intergenic
993126350 5:83840677-83840699 TCTTATATGGGAGTAGTTAGTGG - Intergenic
993270230 5:85787026-85787048 ACTTATTTGGGCATTGTTTGAGG - Intergenic
993349616 5:86832554-86832576 TTTTATATGGGCACAGTTTGTGG + Intergenic
993400469 5:87443578-87443600 TCTTCTGTGGGTGTGGTTTGTGG + Intergenic
993787309 5:92159181-92159203 TCTTATATGGGTGCTGTTTGTGG - Intergenic
993918795 5:93774121-93774143 TCTTCTATGGGTACAGTTTGTGG - Intronic
994255809 5:97594707-97594729 TCTTGTATGGTCATGGTTTGTGG + Intergenic
994466992 5:100148812-100148834 TCTTATGTGGGCATGGTTTGTGG + Intergenic
994628730 5:102254473-102254495 TCTTAAAGGGGCATGGTTCATGG - Intronic
994827738 5:104736697-104736719 TCTTGTATGGATGTGGTTTGTGG + Intergenic
994870295 5:105339490-105339512 TCTTATATGGGTACAGTTTGTGG + Intergenic
994967122 5:106688377-106688399 TCTTTTATGGGCATGGTTCATGG - Intergenic
995426157 5:112025795-112025817 TCTTATATGGGCATGGTTTGTGG - Intergenic
995431234 5:112080228-112080250 TCTTATATGGGCATGGTTCATGG - Intergenic
995505817 5:112859890-112859912 TCTTATCTGGGCATGGTTCATGG + Intronic
995678513 5:114690816-114690838 TCTCACATGGGTATGGTTTATGG + Intergenic
995741614 5:115361723-115361745 TCTTATATGGTGATGGTTCATGG + Intergenic
995886938 5:116905818-116905840 TCTTATACGGGCATGGTTCAAGG - Intergenic
996512521 5:124332880-124332902 TCTTATATGGGCATGGTTTGTGG + Intergenic
996586612 5:125095380-125095402 TCTTATATGGGTGTGGTTTGTGG - Intergenic
996660400 5:125996153-125996175 TGTTATAAGGACATGGTTTATGG - Intergenic
996673159 5:126143287-126143309 TCTTATATGGGTATGGTTTGTGG - Intergenic
996841975 5:127856823-127856845 TCTTATATGGGTACAGTTTGTGG + Intergenic
997021444 5:130007532-130007554 AGTTAAATAGGCATGGTTTGTGG + Intronic
997162904 5:131627933-131627955 TCTTACATGGGCACAGTTTGTGG - Intronic
997176201 5:131780684-131780706 TCTTATATGGGCACAGTTCCTGG - Intronic
997274305 5:132571088-132571110 TCTTATATGTGGATGGTTTGTGG + Intronic
997961473 5:138325199-138325221 TCTTTTATGGTAATGATTTGGGG + Intronic
998510296 5:142707636-142707658 TCTTATATGAGCACAGTTTATGG - Intergenic
998814553 5:145999708-145999730 TCTTGTATGGGCAAAGTTTGTGG + Intronic
998863646 5:146472493-146472515 TCTTACATGGGTGTGGTTTGTGG - Intronic
999432970 5:151539975-151539997 GCATATATGGGCATGGGGTGAGG + Intronic
999801219 5:155038873-155038895 TCTTATATGGGCGTGGTTAATGG + Intergenic
1000129264 5:158279661-158279683 TCTTCTATGGGCATGGTTTGTGG - Intergenic
1000453800 5:161423564-161423586 TCTTATATGGACATGCTTCGTGG - Intronic
1000578183 5:163002423-163002445 TCATAGATGGGCATTCTTTGAGG - Intergenic
1000782645 5:165502271-165502293 TCTTCTATGGGTGTAGTTTGTGG + Intergenic
1000821259 5:165987190-165987212 TCTTATATGGGCATGCTTTGTGG - Intergenic
1001091338 5:168743448-168743470 TCTTTGATGGGCATGGTTCGTGG - Intronic
1001655863 5:173349129-173349151 TCTTATATGGGTGCCGTTTGGGG - Intergenic
1002487204 5:179547371-179547393 TCTTATATGGGTGCAGTTTGTGG + Intergenic
1002813092 6:653052-653074 TCTCATATGAGCATGGTTTGTGG - Intronic
1002822745 6:742281-742303 TCTTATATGGGCTCAGTCTGTGG + Intergenic
1002985059 6:2181690-2181712 TTTTGTATGGGCTTGGTTTGTGG - Intronic
1003275070 6:4643442-4643464 TCTTCTATGGGCATAGTTCGTGG + Intergenic
1003598781 6:7499446-7499468 TCTTATATGGGCGTGGCTTGTGG + Intergenic
1003662776 6:8078380-8078402 TCTTATATGGGCATGGCTTGTGG + Intronic
1003706081 6:8531939-8531961 TCTTATATGGGCACAGTTCATGG - Intergenic
1003822875 6:9919683-9919705 CCTTATATGGGCATGGTTTATGG - Intronic
1004152848 6:13136853-13136875 TCTTATATGGGTGTGATTTGTGG + Intronic
1004371593 6:15057344-15057366 TCTTATATGGGCGTAGTTCATGG + Intergenic
1004569322 6:16830197-16830219 TCTTCTATGGGCACGGCTGGCGG + Intergenic
1004658157 6:17684903-17684925 TCTTATATGGGTGTGGCTCGTGG + Intronic
1004922823 6:20392949-20392971 TCTTATATGGGTGTGTTTAGTGG + Intergenic
1004972229 6:20923501-20923523 TCTCATATGGGCATAGTCCGTGG - Intronic
1004978605 6:20996580-20996602 TCTTATATGGGCGCGGTTTGTGG + Intronic
1005689879 6:28293716-28293738 TTTTAAACGGGCATGGTTTGTGG - Intronic
1005703317 6:28426485-28426507 TCTTATATGGGTGTGGTTAGCGG + Intergenic
1006959713 6:37916112-37916134 GCTTGTATGGGCATAGTTTATGG + Intronic
1007884227 6:45207735-45207757 TTTTATATGGGCCTGGTTCTTGG - Intronic
1008152267 6:47968288-47968310 TCTTACATGGGTGTGGTTTGTGG + Intronic
1008197693 6:48544779-48544801 TGTCATATGGGTATGGTTTTTGG + Intergenic
1008268921 6:49466199-49466221 TCTGATATTGGCATGGTTCATGG + Intronic
1008319415 6:50089688-50089710 TCTTATATGTGTGTGATTTGCGG - Intergenic
1008721633 6:54361069-54361091 TCTTATATGGGTGCTGTTTGCGG - Intronic
1008831640 6:55770891-55770913 TCTTATATGGGTAAAATTTGTGG + Intronic
1008916822 6:56797192-56797214 TCTTATATGGTTGTGGCTTGTGG - Intronic
1008975172 6:57417621-57417643 TCTTATAGGGGCATAGTTGATGG + Intronic
1009164057 6:60319140-60319162 TCTTATAGGGGCATAGTTGATGG + Intergenic
1009240521 6:61180608-61180630 TCTTACATAGGTATGGTTTCTGG - Intergenic
1009431209 6:63568435-63568457 TCTTAAATGGGTACAGTTTGTGG + Intronic
1009461061 6:63914040-63914062 TCTTATATAGGAGTGGTTTGTGG - Intronic
1009525700 6:64742280-64742302 TCTTATATGGGTGTGGCTTATGG + Intronic
1009590015 6:65656080-65656102 TCTTATATGGGCATGGTTTGTGG - Intronic
1009867130 6:69411586-69411608 CCTTGTATTTGCATGGTTTGAGG - Intergenic
1009963380 6:70551805-70551827 TCTTACATAGGCATGGTTCATGG + Intronic
1010064796 6:71669742-71669764 TCTTATATGTGCATGGGTCATGG - Intergenic
1010241418 6:73619160-73619182 TCTTATATGGGGAAGGATTATGG + Intronic
1010608478 6:77921837-77921859 TCTGATATGGGCATGGTTTGTGG + Intronic
1010693143 6:78934182-78934204 TCTTATATGGGTGTGGTTTGTGG + Intronic
1010724600 6:79318995-79319017 CGTCACATGGGCATGGTTTGTGG + Intergenic
1010898469 6:81396033-81396055 GATTATATGGGCACGGTTTGTGG - Intergenic
1011029405 6:82905402-82905424 CTATATATGGGCATGATTTGTGG - Intronic
1011115656 6:83888536-83888558 TCTCATATGGGCTCGATTTGTGG - Intronic
1011218019 6:85026014-85026036 TCTTTTATGGGCACAGTTTGTGG - Intergenic
1011391757 6:86861565-86861587 TCTTATATGGGTGTAGTTTGTGG + Intergenic
1011446659 6:87448696-87448718 ACTTATATGGGCATGATCTATGG + Intronic
1011868797 6:91866288-91866310 TATTATATGGGCATGGTGGTGGG + Intergenic
1011965595 6:93153849-93153871 TCATATATTTGCATGCTTTGAGG + Intergenic
1012304525 6:97636443-97636465 TCTTCTATAGGCATGGTTCGTGG - Intergenic
1012918432 6:105196166-105196188 TCTTATGTGGGTGTGGCTTGTGG - Intergenic
1012983317 6:105852256-105852278 TCTTATATGGGCACAGTTTGTGG + Intergenic
1013088826 6:106880546-106880568 TCTTACATGAGTGTGGTTTGTGG + Intergenic
1013414684 6:109914035-109914057 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1013729760 6:113151265-113151287 TCTTATATGGGCATGACTTGTGG + Intergenic
1013739795 6:113268897-113268919 TCTTATATGGGCATGGTTTGTGG - Intergenic
1013796102 6:113890882-113890904 TCTTCTATGGGTGTGGTTTTTGG - Intergenic
1013933101 6:115559127-115559149 TGTCATATGGGCATTGTTTGTGG - Intergenic
1013943575 6:115695258-115695280 TTTTATATGGGCATGGTTTGTGG - Intergenic
1014076404 6:117240445-117240467 TCTTATATAGGCATGGTTTGTGG - Intergenic
1014521510 6:122449033-122449055 TCTTATATGGGTGTGATTTGTGG - Intronic
1014528296 6:122527619-122527641 TTTTATATGGGAATGGTTTGTGG + Intronic
1014590586 6:123262824-123262846 CCTTATATGGGTGTGGTGTGTGG - Intronic
1014741389 6:125151518-125151540 TCTTATATGGGCATGGATCAGGG - Intronic
1014742453 6:125161709-125161731 TCTTATATGGGCATAGTTCATGG + Intronic
1014856118 6:126403080-126403102 TCTTGTATGGGCATAATTTGTGG - Intergenic
1015337014 6:132050954-132050976 TGTTTTGTGGGCATGGTTTGTGG - Intergenic
1015433407 6:133156432-133156454 TCTTACATGGGCACAGTTTGTGG + Intergenic
1015640710 6:135328486-135328508 TCTTCTATGGCTATGGTTTATGG - Intronic
1015648301 6:135421126-135421148 TCTTATATGGGTACAGTTTGTGG + Intronic
1015939723 6:138435946-138435968 TCTTATGTGGGTGTGATTTGTGG - Intronic
1016081599 6:139863928-139863950 TCTTATATGGGCACAGTTTGTGG - Intergenic
1016220371 6:141661784-141661806 TCTTATATGGGAGTGATTTGTGG + Intergenic
1016344188 6:143093877-143093899 TCTTCTATGGGTGAGGTTTGAGG + Intronic
1016490841 6:144600048-144600070 TCTTATATGGGTGTGGCTTGAGG - Intronic
1016616948 6:146061141-146061163 TCTTATATGGGCATGGTTCATGG + Intronic
1016794053 6:148098906-148098928 TCTTATATGGGCATGGTTTGTGG - Intergenic
1016847995 6:148587968-148587990 TCTTATCTGAGCATGGTTGGTGG - Intergenic
1016867382 6:148780892-148780914 TCTTATATGGGTGCAGTTTGTGG - Intronic
1016890354 6:149000214-149000236 TCTTATAAGGGCATAGTTCCAGG - Intronic
1016903262 6:149123107-149123129 TCTTATCAGGGCATGGTTTATGG - Intergenic
1016946161 6:149536140-149536162 TCTTATATGGGCACAGTTTGTGG - Intronic
1017314359 6:153013296-153013318 TCTTATATGGGCATGGTTCATGG - Intronic
1018250592 6:161866163-161866185 TCTTATTTGGGCATGGTTTTTGG + Intronic
1018294747 6:162333547-162333569 TTTTATATAGGCATGGTTGGTGG - Intronic
1019159495 6:170059606-170059628 TCTTACATGGATGTGGTTTGTGG - Intergenic
1019590908 7:1831315-1831337 TCTCTTATGGGCACTGTTTGTGG - Intronic
1019821954 7:3250789-3250811 TGTCATATGGGCGTGGTTTTTGG - Intergenic
1020090773 7:5339160-5339182 TCTTATATGGGCACTGTTCACGG - Intronic
1020409229 7:7872451-7872473 TCTTACATGGGCATGGTTCGTGG + Intronic
1020523276 7:9222690-9222712 TCTTATATGGGCGTGATTCATGG - Intergenic
1020549014 7:9574325-9574347 TCTTAGATAAGCATGATTTGTGG + Intergenic
1020596875 7:10217737-10217759 TCTTATATCAGCATTGTTTGTGG + Intergenic
1020626177 7:10582350-10582372 TCTTATATGAACACAGTTTGAGG - Intergenic
1020727648 7:11835799-11835821 TTTTATATGGGCACAGTATGTGG - Intergenic
1020802014 7:12743593-12743615 TCTTATATGACCATGGTGTGTGG - Intergenic
1020944540 7:14585862-14585884 TCTTACATGGGCGTGGTTCATGG - Intronic
1021132810 7:16931589-16931611 TCTTATATGGGTGTAGTTTGTGG + Intergenic
1021267980 7:18548234-18548256 TCTTATATGGGTGTGGTTCGTGG + Intronic
1021285379 7:18775132-18775154 TCTTATATGGGCACGATTCATGG + Intronic
1022186804 7:27977387-27977409 TCTTATGTGGGTTTGGTTTTAGG + Intronic
1022392218 7:29953082-29953104 TCATATTTGGGAATGCTTTGAGG - Intronic
1022474947 7:30703864-30703886 TCTGATATGAGAATGGTCTGTGG - Intronic
1022594537 7:31699871-31699893 TCTTATATGGGCGAGGTCTGTGG - Intronic
1022951366 7:35341348-35341370 TCTTATATGGGCACAGTTTGTGG - Intergenic
1023099988 7:36707330-36707352 TCTTATATGGGTGTGGTTCATGG + Intronic
1023193494 7:37609242-37609264 TTGTACATGAGCATGGTTTGTGG - Intergenic
1023635374 7:42204230-42204252 TGTTGGATAGGCATGGTTTGGGG - Intronic
1024133292 7:46379394-46379416 TCTTATGTGGGCATGGCTTGTGG - Intergenic
1024336713 7:48215350-48215372 TCTTATATGGGCATGGTTTGTGG + Intronic
1024786150 7:52910618-52910640 TCTTATATGGGCTTAGTTTTTGG + Intergenic
1024877291 7:54040309-54040331 TCTTATATGAGCACAGTTTATGG + Intergenic
1025844321 7:65182582-65182604 TCTTATACAGGCACAGTTTGTGG - Intergenic
1025894649 7:65688916-65688938 TCTTATACAGGCACAGTTTGTGG - Intergenic
1026092686 7:67314675-67314697 TCTTATATGGGCATGGTTCGTGG + Intergenic
1026330565 7:69348597-69348619 TCTTATATGGGAGTGGTTCATGG + Intergenic
1027296240 7:76774523-76774545 TCTTATGTGAGCATGGTTTGTGG + Intergenic
1027526413 7:79274909-79274931 TATCATATGGGCATGGTTCATGG - Intronic
1027596045 7:80175744-80175766 TCTTATGTGGGCAGAGTTTATGG - Intronic
1027908871 7:84221724-84221746 TCTTACATAGGCATAGTTTATGG + Intronic
1028138866 7:87249798-87249820 TCTTATATGTGAAGGATTTGTGG - Intergenic
1028578230 7:92377348-92377370 TCTTATATGGGCATGGTTCATGG + Intronic
1028870519 7:95766610-95766632 TCTTTTGTGGGCATGGTTCATGG - Intergenic
1029378124 7:100194452-100194474 TCTTATATGGGCACGGTTTGTGG + Intronic
1030100572 7:105941650-105941672 TCTTTTAGGGGCTTTGTTTGGGG - Intronic
1030172934 7:106622878-106622900 TCCTATATGGGCATGGTTCATGG + Intergenic
1030289619 7:107859085-107859107 TCTCATATTGGGCTGGTTTGTGG - Intergenic
1030479130 7:110080250-110080272 TTTTATATGGGCACGGTTTGTGG + Intergenic
1030505170 7:110412293-110412315 TCTTATATGGTCATAGTTTATGG + Intergenic
1030567714 7:111180446-111180468 TCTTACATGGGTGAGGTTTGTGG + Intronic
1030693340 7:112557441-112557463 TCTGATTTGGGTATGGTATGTGG - Intergenic
1030698305 7:112610576-112610598 TCTTATGTGGGCATGGTTCATGG - Intergenic
1030992958 7:116323461-116323483 TCTTATATGGGCATGGTTAGTGG - Intronic
1031057316 7:117006895-117006917 TCTTATATGGATGTGGTTTGCGG - Intronic
1031103156 7:117507135-117507157 TCTGATCTGGGCCTGGTATGTGG + Intronic
1031183699 7:118448804-118448826 TCTTATATGGGTGTAGTTTGTGG + Intergenic
1031498729 7:122485031-122485053 TCTTATATGGGTGTAGTTTGTGG - Intronic
1031564555 7:123279141-123279163 TCTTATATGGGTGGGGTTTGTGG + Intergenic
1031654876 7:124342347-124342369 TCTTATATGGGCATGGTTCCTGG + Intergenic
1031878366 7:127167655-127167677 TTTTATATGGGCACAGTTCGTGG - Intronic
1032235526 7:130118863-130118885 TTTTATATGGGCGTGGTTCATGG + Intronic
1032558630 7:132864371-132864393 TTTTATATGGGTGTGGTCTGTGG + Intronic
1032712988 7:134478436-134478458 TCTTATATGGACACGGTTCATGG + Intergenic
1032927773 7:136628699-136628721 TCTTGCATGGGCACAGTTTGTGG - Intergenic
1033107574 7:138542430-138542452 TCTTACATGGGTGTGGTTTGTGG + Intronic
1033139804 7:138816084-138816106 TCTTATATGGGTGAGGTTGGTGG - Intronic
1033140865 7:138825211-138825233 TGTTCTATGGGCATGGTTCATGG - Intronic
1033152816 7:138931122-138931144 TTGTATATGGGCAGAGTTTGCGG + Intronic
1033388417 7:140902289-140902311 CCTTATATGGGTGTGGTTCGTGG - Intronic
1033795276 7:144838292-144838314 TCTTATAAGGGCATGGCTGGTGG - Intergenic
1034210800 7:149360356-149360378 TCTTATATGGGTTTGGTTCATGG - Intergenic
1034611679 7:152376135-152376157 TCTTATGTGGGCGTGGTTCATGG - Intronic
1034924288 7:155108501-155108523 TCTTGTATTGCCATGGCTTGTGG - Intergenic
1035066964 7:156112948-156112970 TCTTCTATGCGTATGGTTTGTGG + Intergenic
1035167124 7:156998165-156998187 TCTTATATGGGCAAGGTTTGTGG + Intronic
1035387075 7:158480311-158480333 TCTTCTATGGGCACGGTTCATGG - Intronic
1035796117 8:2358481-2358503 TCCTAGATGGTCAGGGTTTGGGG + Intergenic
1035962919 8:4157648-4157670 TGTTATCTGGGCATGGGGTGAGG + Intronic
1036469106 8:9034565-9034587 TCTTATATGGGTGTGGTCTGTGG - Intronic
1037191741 8:16134446-16134468 TCTTTTACGGGCATGGTTTGTGG - Intronic
1037366807 8:18131134-18131156 TATTATATGGTCTTGCTTTGTGG - Intergenic
1037435633 8:18860234-18860256 CGTTATATGGGCATGGTTTATGG + Intronic
1038184935 8:25264492-25264514 TGCTATATGGGAATGGATTGTGG - Intronic
1038526891 8:28282462-28282484 TCTTCCATGGGCACGGTTTGTGG - Intergenic
1038827915 8:31026132-31026154 TCTTATAAGGGCAAGGTCTTTGG + Intronic
1039212291 8:35231480-35231502 TCTTATATGAGCATGGTTCATGG + Intergenic
1039255477 8:35714153-35714175 TCAAATATGAGAATGGTTTGAGG + Intronic
1039767372 8:40643700-40643722 GCTTAAATGGGCATCTTTTGGGG - Intronic
1039903563 8:41769696-41769718 TCTTATGTGGCCATGGTTTCAGG - Intronic
1040722767 8:50346353-50346375 TCTGATACGGGCACAGTTTGTGG - Intronic
1040754030 8:50748780-50748802 TCTTATATGGGCACAGTTCATGG - Intronic
1040774128 8:51018470-51018492 TCTTATATGGGCGTGGTGTGTGG + Intergenic
1041100153 8:54388336-54388358 TCTTATGTGGGTGTGGCTTGTGG + Intergenic
1041372570 8:57178169-57178191 TCTCAGGTGGGCACGGTTTGCGG + Intergenic
1041432295 8:57796312-57796334 TCTTATATTGGCACAGTTTCTGG - Intergenic
1041926265 8:63240182-63240204 TCTCATATGAGTAGGGTTTGTGG + Intergenic
1042363127 8:67905128-67905150 TATTATAAGGACAAGGTTTGGGG - Intergenic
1042409843 8:68451653-68451675 TCTTACATGGGTGTGGTTTGTGG + Intronic
1042686755 8:71450480-71450502 TCTTATATGGGCATGGTTTGTGG + Intronic
1042829621 8:73012228-73012250 TGTCTTATGGGCATGATTTGTGG + Intronic
1042882423 8:73508438-73508460 TCTTATATGGGCATGATTTGTGG + Intronic
1043098999 8:76016115-76016137 TCTTATATGGGAATAGTTTGTGG - Intergenic
1043601308 8:81941780-81941802 TCTTATCTGTGCATGGTTCATGG - Intergenic
1043862719 8:85339380-85339402 TCTTACTTGGACATGGTTTATGG - Intronic
1043990891 8:86752662-86752684 TCTTATATGGGCATAGTTTGTGG + Intergenic
1044030897 8:87235590-87235612 TCTTATATGTGCATAGTTTGCGG + Intronic
1044114304 8:88315564-88315586 TCTTAAATGGGCAGAGTTTGTGG - Intronic
1044289506 8:90451265-90451287 TCTTACGTGAGCATGGTTTTTGG + Intergenic
1044461189 8:92446356-92446378 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1044570707 8:93714955-93714977 TCTGATAAGGGCAGAGTTTGTGG + Intronic
1044807729 8:96025396-96025418 TCTTATATGGGTAGGGTTTGTGG - Intergenic
1045067906 8:98468313-98468335 TTTTAGAATGGCATGGTTTGTGG + Intronic
1045399813 8:101802222-101802244 TATTTTATGGGCATGGTTTGTGG - Intronic
1045449703 8:102310146-102310168 TCTGATTTGGGCATGGTTGATGG - Intronic
1046652977 8:116859581-116859603 TATTATTTGGGCATCCTTTGTGG - Intronic
1047106512 8:121736791-121736813 TCTTCTATGGGCATAGTTTGTGG + Intergenic
1047147710 8:122223427-122223449 TCTTCTATGGGTGTGGTTTGTGG + Intergenic
1047576963 8:126166714-126166736 TCTCATATGGGCATGGCTTATGG + Intergenic
1047888789 8:129283385-129283407 TCTTATATGGAAGTGATTTGTGG - Intergenic
1048604942 8:135957872-135957894 TCGTATATGGTCATAGTTTGTGG - Intergenic
1048824349 8:138409326-138409348 TCTTACATGGGCATGCTTCATGG + Intronic
1048902460 8:139051866-139051888 TCTTATGTGAACATGGTTTGTGG - Intergenic
1050321433 9:4456846-4456868 TTGTATATGGGCATGGTTCATGG + Intergenic
1050349601 9:4728005-4728027 TCTTATATGGGTATAGTTCATGG + Intronic
1050565105 9:6874025-6874047 TCTTATGTGGGCATGGTTTGTGG + Intronic
1051064378 9:13084749-13084771 TCTCATATGGGCACAGTTTGTGG - Intergenic
1051085039 9:13338517-13338539 TCTTACATGGGCATGGTTCATGG + Intergenic
1051123744 9:13780308-13780330 TCTTATATGGGCAACGTTCATGG - Intergenic
1051147207 9:14040081-14040103 TCTTATATAGGTGTGATTTGTGG + Intergenic
1051254125 9:15194786-15194808 TCTTATATGGGTGTGGTTCAGGG - Intronic
1051305466 9:15703866-15703888 TCTTCTATGGGCATGGTTTGTGG + Intronic
1051601702 9:18881520-18881542 TTTTATATGAGCATGGTTCATGG + Intronic
1051721608 9:20042886-20042908 TCTTACATGGGCATGGCTTGTGG - Intergenic
1051753568 9:20370318-20370340 TCTTACATGGGTGCGGTTTGTGG - Intronic
1051767777 9:20543392-20543414 TCTTACATGGGTATGGCTTATGG + Intronic
1051770764 9:20576626-20576648 TCTTATATGGGCACGCTTCATGG + Intronic
1051853016 9:21530741-21530763 TCTTATATGGGTATGGTTCATGG + Intergenic
1052111336 9:24586809-24586831 TCTTACATGGGCACGGTTACTGG + Intergenic
1052371365 9:27668644-27668666 TTTTATATGGGTGGGGTTTGTGG + Intergenic
1053208709 9:36209589-36209611 TCTTATCTGGGAACGGTTTGAGG + Intronic
1053217773 9:36286941-36286963 TCTTATATGGGTGCGATTTGTGG + Intronic
1053296470 9:36917950-36917972 TCTTATATGGGCACAGTTTGTGG - Intronic
1053610651 9:39709952-39709974 TCTAATATGGGAATTGATTGAGG - Intergenic
1054242871 9:62632443-62632465 TCTAATATGGGAATTGATTGAGG + Intergenic
1054556996 9:66666961-66666983 TCTAATATGGGAATTGATTGAGG + Intergenic
1054994493 9:71370039-71370061 TGTTATGTGGGTATGGTTTGTGG - Intronic
1055781388 9:79825085-79825107 TTTGAGCTGGGCATGGTTTGGGG - Intergenic
1055873983 9:80920614-80920636 TCTTACATGGGTATGGTTTGCGG + Intergenic
1055906513 9:81300780-81300802 TCTTATATGGGCAGGGTTCACGG - Intergenic
1056227201 9:84507315-84507337 TCTTATATGTGCATGGCTTGTGG - Intergenic
1056274276 9:84977952-84977974 TCTTACATGGATATAGTTTGTGG - Intronic
1057538977 9:95946878-95946900 TTTTATAGGGGCATGGTTCATGG - Intronic
1057823714 9:98355157-98355179 TCTTATCTGGGCATGGTTTGTGG + Intronic
1058196361 9:101981725-101981747 TCTTATATGGGCACAGTTCATGG - Intergenic
1058641723 9:107093593-107093615 TCTTACATGGGTGTGGTTTATGG + Intergenic
1059158097 9:112007613-112007635 TCTTATATGGGCATGGTTTGTGG - Intergenic
1059264747 9:113016623-113016645 TCTTATATGTGCATGGTCTGTGG - Intergenic
1059290102 9:113215449-113215471 TTTTATGTGAGCGTGGTTTGTGG + Intronic
1059844279 9:118255183-118255205 TCTTATATGGGTGTGGTTCATGG - Intergenic
1060066437 9:120505308-120505330 TCTTATATGGGTGTGATTTGAGG - Intronic
1060460424 9:123848427-123848449 TCTTATATGGGCATGGTTTATGG - Intronic
1061155837 9:128860887-128860909 TCTTATATGGGCATGGTTTGTGG + Intronic
1186298608 X:8175462-8175484 TCTTATATGGGCCCAGTTTCTGG - Intergenic
1186539586 X:10386894-10386916 TCTTATCTGGGACTGATTTGAGG - Intergenic
1186953321 X:14652645-14652667 TCTTATATGGGCATGGTTCCTGG - Intronic
1186969877 X:14830173-14830195 TCTTATATGGGTGTGGTTTGTGG + Intergenic
1187474470 X:19598766-19598788 TCTTATATGGGCACAGTTTATGG + Intronic
1187516607 X:19977037-19977059 TCTTATAAGGGCATGGTTCATGG - Intergenic
1187800397 X:23055959-23055981 TCTTATATGGGCATGGTTCATGG - Intergenic
1187890345 X:23928697-23928719 TCTTATATGGGCTCAGTTTGTGG - Intronic
1188093026 X:25987113-25987135 TCTTATATGGGAGTGGTTCATGG - Intergenic
1188221912 X:27551028-27551050 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1188291452 X:28393695-28393717 TCTTGTATGTGCATGGTTTGTGG + Intergenic
1188329900 X:28856676-28856698 TCCTATGTGGGCATGGTTTGTGG - Intronic
1188469131 X:30517619-30517641 TCTTATATGGTCATAGTTTGTGG - Intergenic
1188591391 X:31840769-31840791 TCCTATATGGGCACTGTTTGTGG - Intronic
1188844446 X:35056313-35056335 TCTTATATGGGTACTGTTTTTGG + Intergenic
1189060166 X:37745207-37745229 TCTTATATGGGTGTGGTTTGTGG + Intronic
1189072429 X:37877929-37877951 TTTTATATGAGCATGGTTCATGG - Intronic
1189174556 X:38942578-38942600 TCTTATATGGGCACGGTTCTTGG - Intergenic
1189869037 X:45362898-45362920 TCTTATTTTGGCAAGGTTTATGG - Intergenic
1189930869 X:46008395-46008417 TCTTATATGGGCATTGTTTGTGG + Intergenic
1190141940 X:47854720-47854742 TCTTCTATGCGCATGGTTCGTGG + Intronic
1190460827 X:50672133-50672155 TCTTATATGGGCACAGTTTGTGG + Intronic
1190486600 X:50932417-50932439 TCTTATATGGGTACAGTTTATGG - Intergenic
1191803813 X:65111748-65111770 TCTTATATGGGCATGGTTTGTGG - Intergenic
1191957784 X:66664951-66664973 TGTCATATGGGCATGGTTTGTGG + Intergenic
1192028745 X:67485981-67486003 TCTTACATTGGCATGAGTTGTGG + Intergenic
1192328684 X:70156076-70156098 TCTTCTGTGGGCATGGTTTGTGG + Intronic
1192606556 X:72524959-72524981 TTTTCCATGGGCATGGTTGGGGG + Intronic
1193055918 X:77150301-77150323 TCTTATATGGGTGTGGTTCTTGG + Intergenic
1193286533 X:79721494-79721516 TTATACATTGGCATGGTTTGGGG - Intergenic
1193569038 X:83118807-83118829 TCTTGTATGGGCATGGTTCGTGG + Intergenic
1193833359 X:86314009-86314031 TTTTACATGGGCATGGTTTGTGG - Intronic
1193850018 X:86525782-86525804 TCTCATTTGGGGATGGTTTGAGG - Intronic
1193906000 X:87244898-87244920 TCTTATTTGGGGGTGGTTTAGGG - Intergenic
1194100510 X:89697422-89697444 TTTTACATGGGTATGGTTTGTGG + Intergenic
1194141242 X:90212996-90213018 TCCTATATGAGTGTGGTTTGTGG + Intergenic
1194167869 X:90542876-90542898 TTTTATATGGGCGTGGTTCATGG + Intergenic
1194286475 X:92017116-92017138 TTTTATATGAGCAAGGTTTGTGG + Intronic
1194326333 X:92522387-92522409 TCTTATCTAGGCCTGGTTTGTGG + Intronic
1194779156 X:98002004-98002026 TCTTATATGGTCTTGTTTTATGG - Intergenic
1194940208 X:100000104-100000126 TCTTAAAAAGGCATGGTTTGTGG - Intergenic
1195231184 X:102849921-102849943 TCTTAGATGGGTGTAGTTTGTGG + Intergenic
1195338729 X:103883445-103883467 TCTTATATGGGCACAGTTCATGG - Intergenic
1195431364 X:104793138-104793160 TCATATATGGGCTTCTTTTGTGG + Intronic
1195593332 X:106657761-106657783 TCTCACATGGGTGTGGTTTGTGG + Intronic
1195628394 X:107028474-107028496 TCTTATATGGGCATAGTTTGTGG + Intergenic
1195690916 X:107624493-107624515 TCTTATATAGGCATGGTTCATGG + Intergenic
1195818955 X:108921688-108921710 TCTTATATGGGTATGGTTTGTGG - Intergenic
1195987931 X:110651438-110651460 TCTTATATGGGCATGGTTTGTGG + Intergenic
1196000192 X:110775011-110775033 TCTTCTATTGGTATGGTCTGTGG - Intronic
1196029316 X:111078477-111078499 TCTTATATGGGCATAGTTCATGG - Intronic
1196067330 X:111478500-111478522 TCTTATCTGGGTGTGGCTTGTGG + Intergenic
1196564041 X:117183726-117183748 TCTTACATAGGCATGGTTGGTGG - Intergenic
1196578043 X:117343969-117343991 TCTTATCTGGGTGTGGTTCGTGG + Intergenic
1197114047 X:122810968-122810990 TCTTATAAGGGCATGGTCCATGG - Intergenic
1197444172 X:126528183-126528205 TCTTATATGGGTGTGGTTCGTGG + Intergenic
1197473708 X:126894291-126894313 TCTTATATGGGTGTGGTTTGTGG - Intergenic
1197561591 X:128029226-128029248 TCTTTTATGGGCATGGTTTGTGG + Intergenic
1197628179 X:128827032-128827054 TCTTATATGGGTATGGTTCATGG - Intergenic
1198323152 X:135539879-135539901 TCTTATGTGGGTATGGTTCATGG + Intronic
1198542892 X:137659075-137659097 TCCTATATGGGCACCGTTTATGG - Intergenic
1198621366 X:138514343-138514365 TCTTATATGAACATGGTTTTTGG + Intergenic
1198634596 X:138681877-138681899 TCTTATATGGCCATGATCTGTGG + Intronic
1198826663 X:140705377-140705399 TTTTATATGGGCACAGTTTATGG + Intergenic
1198970688 X:142275704-142275726 TCTTTTATGGGCACAGTTTGTGG + Intergenic
1198999700 X:142620220-142620242 TCTTATATGGGTGTGGTTTATGG + Intergenic
1199090659 X:143688139-143688161 TCTTATATGGCCATGGTTTGTGG + Intergenic
1199103011 X:143827911-143827933 TTTTATATGGGCATAGTTTGTGG - Intergenic
1199281393 X:146004207-146004229 TCTTATATGGATGGGGTTTGTGG - Intergenic
1199334072 X:146598401-146598423 TCTTATATGTTTTTGGTTTGAGG + Intergenic
1199343756 X:146714126-146714148 TCGTATATGGGCATGTTTCAGGG - Intergenic
1199359239 X:146898342-146898364 TCTTACATAGGCGTGGTTTGTGG - Intergenic
1200453462 Y:3358483-3358505 TTTTACATGGGTATGGTTTGTGG + Intergenic
1200486996 Y:3782098-3782120 TCCTATATGAGTGTGGTTTGTGG + Intergenic
1200604019 Y:5241667-5241689 TTTTATATGAGCAAGGTTTGTGG + Intronic
1200635054 Y:5641589-5641611 TCTTATCTGGGCCTGGTTTGTGG + Intronic