ID: 1013742100

View in Genome Browser
Species Human (GRCh38)
Location 6:113299427-113299449
Sequence GTCCCTTGTATGAGTGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013742094_1013742100 13 Left 1013742094 6:113299391-113299413 CCTCCTTGGTAGACTAGCCCGAG No data
Right 1013742100 6:113299427-113299449 GTCCCTTGTATGAGTGGCCAGGG No data
1013742095_1013742100 10 Left 1013742095 6:113299394-113299416 CCTTGGTAGACTAGCCCGAGATT No data
Right 1013742100 6:113299427-113299449 GTCCCTTGTATGAGTGGCCAGGG No data
1013742097_1013742100 -5 Left 1013742097 6:113299409-113299431 CCGAGATTTATTTACACTGTCCC No data
Right 1013742100 6:113299427-113299449 GTCCCTTGTATGAGTGGCCAGGG No data
1013742096_1013742100 -4 Left 1013742096 6:113299408-113299430 CCCGAGATTTATTTACACTGTCC No data
Right 1013742100 6:113299427-113299449 GTCCCTTGTATGAGTGGCCAGGG No data
1013742093_1013742100 18 Left 1013742093 6:113299386-113299408 CCATACCTCCTTGGTAGACTAGC No data
Right 1013742100 6:113299427-113299449 GTCCCTTGTATGAGTGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013742100 Original CRISPR GTCCCTTGTATGAGTGGCCA GGG Intergenic
No off target data available for this crispr