ID: 1013744595

View in Genome Browser
Species Human (GRCh38)
Location 6:113330473-113330495
Sequence TTGTGTGAACAGTCCAGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013744595_1013744597 -4 Left 1013744595 6:113330473-113330495 CCTGTCCTGGACTGTTCACACAA No data
Right 1013744597 6:113330492-113330514 ACAATAAGTCACTGCAGCTGTGG No data
1013744595_1013744598 23 Left 1013744595 6:113330473-113330495 CCTGTCCTGGACTGTTCACACAA No data
Right 1013744598 6:113330519-113330541 AAGTACAGATTCACACAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013744595 Original CRISPR TTGTGTGAACAGTCCAGGAC AGG (reversed) Intergenic
No off target data available for this crispr