ID: 1013745529

View in Genome Browser
Species Human (GRCh38)
Location 6:113341163-113341185
Sequence TGAAAAACAGTTTCTATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013745529_1013745532 22 Left 1013745529 6:113341163-113341185 CCTGCAATAGAAACTGTTTTTCA No data
Right 1013745532 6:113341208-113341230 TCTGCTTTGGAGAAGATGGAAGG No data
1013745529_1013745531 18 Left 1013745529 6:113341163-113341185 CCTGCAATAGAAACTGTTTTTCA No data
Right 1013745531 6:113341204-113341226 TTCTTCTGCTTTGGAGAAGATGG No data
1013745529_1013745530 9 Left 1013745529 6:113341163-113341185 CCTGCAATAGAAACTGTTTTTCA No data
Right 1013745530 6:113341195-113341217 GTTATATCTTTCTTCTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013745529 Original CRISPR TGAAAAACAGTTTCTATTGC AGG (reversed) Intergenic
No off target data available for this crispr