ID: 1013745530 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:113341195-113341217 |
Sequence | GTTATATCTTTCTTCTGCTT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1013745529_1013745530 | 9 | Left | 1013745529 | 6:113341163-113341185 | CCTGCAATAGAAACTGTTTTTCA | No data | ||
Right | 1013745530 | 6:113341195-113341217 | GTTATATCTTTCTTCTGCTTTGG | No data | ||||
1013745528_1013745530 | 15 | Left | 1013745528 | 6:113341157-113341179 | CCAGAACCTGCAATAGAAACTGT | No data | ||
Right | 1013745530 | 6:113341195-113341217 | GTTATATCTTTCTTCTGCTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1013745530 | Original CRISPR | GTTATATCTTTCTTCTGCTT TGG | Intergenic | ||
No off target data available for this crispr |