ID: 1013745530

View in Genome Browser
Species Human (GRCh38)
Location 6:113341195-113341217
Sequence GTTATATCTTTCTTCTGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013745529_1013745530 9 Left 1013745529 6:113341163-113341185 CCTGCAATAGAAACTGTTTTTCA No data
Right 1013745530 6:113341195-113341217 GTTATATCTTTCTTCTGCTTTGG No data
1013745528_1013745530 15 Left 1013745528 6:113341157-113341179 CCAGAACCTGCAATAGAAACTGT No data
Right 1013745530 6:113341195-113341217 GTTATATCTTTCTTCTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013745530 Original CRISPR GTTATATCTTTCTTCTGCTT TGG Intergenic
No off target data available for this crispr