ID: 1013745532

View in Genome Browser
Species Human (GRCh38)
Location 6:113341208-113341230
Sequence TCTGCTTTGGAGAAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013745529_1013745532 22 Left 1013745529 6:113341163-113341185 CCTGCAATAGAAACTGTTTTTCA No data
Right 1013745532 6:113341208-113341230 TCTGCTTTGGAGAAGATGGAAGG No data
1013745528_1013745532 28 Left 1013745528 6:113341157-113341179 CCAGAACCTGCAATAGAAACTGT No data
Right 1013745532 6:113341208-113341230 TCTGCTTTGGAGAAGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013745532 Original CRISPR TCTGCTTTGGAGAAGATGGA AGG Intergenic
No off target data available for this crispr