ID: 1013747506

View in Genome Browser
Species Human (GRCh38)
Location 6:113363113-113363135
Sequence CTAAAAAGGATAATTGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013747506_1013747509 17 Left 1013747506 6:113363113-113363135 CCAGCTACAATTATCCTTTTTAG No data
Right 1013747509 6:113363153-113363175 CCTTGACCCACAGAAATTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013747506 Original CRISPR CTAAAAAGGATAATTGTAGC TGG (reversed) Intergenic
No off target data available for this crispr