ID: 1013750901

View in Genome Browser
Species Human (GRCh38)
Location 6:113404990-113405012
Sequence ACTAAAAGTGTCTCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013750893_1013750901 23 Left 1013750893 6:113404944-113404966 CCTCTACACATGAGATGCCAGTA No data
Right 1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG No data
1013750897_1013750901 -6 Left 1013750897 6:113404973-113404995 CCCACCCATTTGTAACAACTAAA No data
Right 1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG No data
1013750898_1013750901 -7 Left 1013750898 6:113404974-113404996 CCACCCATTTGTAACAACTAAAA No data
Right 1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG No data
1013750892_1013750901 28 Left 1013750892 6:113404939-113404961 CCTGGCCTCTACACATGAGATGC No data
Right 1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG No data
1013750896_1013750901 -5 Left 1013750896 6:113404972-113404994 CCCCACCCATTTGTAACAACTAA No data
Right 1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG No data
1013750894_1013750901 6 Left 1013750894 6:113404961-113404983 CCAGTAGCAGCCCCCACCCATTT No data
Right 1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG No data
1013750895_1013750901 -4 Left 1013750895 6:113404971-113404993 CCCCCACCCATTTGTAACAACTA No data
Right 1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG No data
1013750899_1013750901 -10 Left 1013750899 6:113404977-113404999 CCCATTTGTAACAACTAAAAGTG No data
Right 1013750901 6:113404990-113405012 ACTAAAAGTGTCTCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013750901 Original CRISPR ACTAAAAGTGTCTCCAGACA TGG Intergenic
No off target data available for this crispr