ID: 1013753224

View in Genome Browser
Species Human (GRCh38)
Location 6:113431289-113431311
Sequence TGGTGCTGCCTAGGAACAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013753224_1013753227 3 Left 1013753224 6:113431289-113431311 CCTACTGTTCCTAGGCAGCACCA No data
Right 1013753227 6:113431315-113431337 ACATACTCAACAGTAGCTTGAGG No data
1013753224_1013753228 6 Left 1013753224 6:113431289-113431311 CCTACTGTTCCTAGGCAGCACCA No data
Right 1013753228 6:113431318-113431340 TACTCAACAGTAGCTTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013753224 Original CRISPR TGGTGCTGCCTAGGAACAGT AGG (reversed) Intergenic
No off target data available for this crispr