ID: 1013761751

View in Genome Browser
Species Human (GRCh38)
Location 6:113526774-113526796
Sequence GAGCATCACCACTGAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013761751_1013761756 -5 Left 1013761751 6:113526774-113526796 CCTCCCACTCAGTGGTGATGCTC No data
Right 1013761756 6:113526792-113526814 TGCTCCAGCATGCCCTGGAAGGG No data
1013761751_1013761755 -6 Left 1013761751 6:113526774-113526796 CCTCCCACTCAGTGGTGATGCTC No data
Right 1013761755 6:113526791-113526813 ATGCTCCAGCATGCCCTGGAAGG No data
1013761751_1013761760 23 Left 1013761751 6:113526774-113526796 CCTCCCACTCAGTGGTGATGCTC No data
Right 1013761760 6:113526820-113526842 TCATTATTACCCTCTGTATTAGG No data
1013761751_1013761754 -10 Left 1013761751 6:113526774-113526796 CCTCCCACTCAGTGGTGATGCTC No data
Right 1013761754 6:113526787-113526809 GGTGATGCTCCAGCATGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013761751 Original CRISPR GAGCATCACCACTGAGTGGG AGG (reversed) Intergenic