ID: 1013762006

View in Genome Browser
Species Human (GRCh38)
Location 6:113529793-113529815
Sequence CAGAGTAAGAAAAAGTATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013762006_1013762010 -7 Left 1013762006 6:113529793-113529815 CCCCCATACTTTTTCTTACTCTG No data
Right 1013762010 6:113529809-113529831 TACTCTGTTATCAGTTTCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013762006 Original CRISPR CAGAGTAAGAAAAAGTATGG GGG (reversed) Intergenic
No off target data available for this crispr