ID: 1013767055

View in Genome Browser
Species Human (GRCh38)
Location 6:113587187-113587209
Sequence TCTCTCATTCAGGACCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013767055_1013767058 -2 Left 1013767055 6:113587187-113587209 CCTTCCAGGTCCTGAATGAGAGA No data
Right 1013767058 6:113587208-113587230 GAAGTGATTTGACATCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013767055 Original CRISPR TCTCTCATTCAGGACCTGGA AGG (reversed) Intergenic
No off target data available for this crispr