ID: 1013769196

View in Genome Browser
Species Human (GRCh38)
Location 6:113608491-113608513
Sequence CACCAGCCACTGATGGTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013769196_1013769199 -9 Left 1013769196 6:113608491-113608513 CCAAGTACCATCAGTGGCTGGTG No data
Right 1013769199 6:113608505-113608527 TGGCTGGTGACACAGGAAGAAGG No data
1013769196_1013769200 4 Left 1013769196 6:113608491-113608513 CCAAGTACCATCAGTGGCTGGTG No data
Right 1013769200 6:113608518-113608540 AGGAAGAAGGATAAATGAAGAGG No data
1013769196_1013769201 5 Left 1013769196 6:113608491-113608513 CCAAGTACCATCAGTGGCTGGTG No data
Right 1013769201 6:113608519-113608541 GGAAGAAGGATAAATGAAGAGGG No data
1013769196_1013769202 28 Left 1013769196 6:113608491-113608513 CCAAGTACCATCAGTGGCTGGTG No data
Right 1013769202 6:113608542-113608564 TGAGTGTGTGACTTTATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013769196 Original CRISPR CACCAGCCACTGATGGTACT TGG (reversed) Intergenic
No off target data available for this crispr