ID: 1013770300

View in Genome Browser
Species Human (GRCh38)
Location 6:113620925-113620947
Sequence ACAGAGAGACAAGACAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013770300_1013770303 -10 Left 1013770300 6:113620925-113620947 CCAACCCTGTCTTGTCTCTCTGT No data
Right 1013770303 6:113620938-113620960 GTCTCTCTGTCCCATACTCTTGG No data
1013770300_1013770306 6 Left 1013770300 6:113620925-113620947 CCAACCCTGTCTTGTCTCTCTGT No data
Right 1013770306 6:113620954-113620976 CTCTTGGTGAAAATCAACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013770300 Original CRISPR ACAGAGAGACAAGACAGGGT TGG (reversed) Intergenic
No off target data available for this crispr