ID: 1013777306

View in Genome Browser
Species Human (GRCh38)
Location 6:113692640-113692662
Sequence TGAGGAATCTTATTCCTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013777306_1013777311 14 Left 1013777306 6:113692640-113692662 CCTAGAAGGAATAAGATTCCTCA No data
Right 1013777311 6:113692677-113692699 AATGAAGGTTATGATTAAAGTGG No data
1013777306_1013777310 -1 Left 1013777306 6:113692640-113692662 CCTAGAAGGAATAAGATTCCTCA No data
Right 1013777310 6:113692662-113692684 AGAAGGACACAGGTCAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013777306 Original CRISPR TGAGGAATCTTATTCCTTCT AGG (reversed) Intergenic