ID: 1013777309

View in Genome Browser
Species Human (GRCh38)
Location 6:113692658-113692680
Sequence CATTGACCTGTGTCCTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013777309_1013777311 -4 Left 1013777309 6:113692658-113692680 CCTCAGAAGGACACAGGTCAATG No data
Right 1013777311 6:113692677-113692699 AATGAAGGTTATGATTAAAGTGG No data
1013777309_1013777313 19 Left 1013777309 6:113692658-113692680 CCTCAGAAGGACACAGGTCAATG No data
Right 1013777313 6:113692700-113692722 CTGCAGAAGTCACCTGGAAGAGG No data
1013777309_1013777312 13 Left 1013777309 6:113692658-113692680 CCTCAGAAGGACACAGGTCAATG No data
Right 1013777312 6:113692694-113692716 AAGTGGCTGCAGAAGTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013777309 Original CRISPR CATTGACCTGTGTCCTTCTG AGG (reversed) Intergenic
No off target data available for this crispr