ID: 1013777311

View in Genome Browser
Species Human (GRCh38)
Location 6:113692677-113692699
Sequence AATGAAGGTTATGATTAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013777309_1013777311 -4 Left 1013777309 6:113692658-113692680 CCTCAGAAGGACACAGGTCAATG No data
Right 1013777311 6:113692677-113692699 AATGAAGGTTATGATTAAAGTGG No data
1013777306_1013777311 14 Left 1013777306 6:113692640-113692662 CCTAGAAGGAATAAGATTCCTCA No data
Right 1013777311 6:113692677-113692699 AATGAAGGTTATGATTAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013777311 Original CRISPR AATGAAGGTTATGATTAAAG TGG Intergenic
No off target data available for this crispr