ID: 1013777312

View in Genome Browser
Species Human (GRCh38)
Location 6:113692694-113692716
Sequence AAGTGGCTGCAGAAGTCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013777309_1013777312 13 Left 1013777309 6:113692658-113692680 CCTCAGAAGGACACAGGTCAATG No data
Right 1013777312 6:113692694-113692716 AAGTGGCTGCAGAAGTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013777312 Original CRISPR AAGTGGCTGCAGAAGTCACC TGG Intergenic
No off target data available for this crispr