ID: 1013777313 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:113692700-113692722 |
Sequence | CTGCAGAAGTCACCTGGAAG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1013777309_1013777313 | 19 | Left | 1013777309 | 6:113692658-113692680 | CCTCAGAAGGACACAGGTCAATG | No data | ||
Right | 1013777313 | 6:113692700-113692722 | CTGCAGAAGTCACCTGGAAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1013777313 | Original CRISPR | CTGCAGAAGTCACCTGGAAG AGG | Intergenic | ||