ID: 1013782100

View in Genome Browser
Species Human (GRCh38)
Location 6:113740049-113740071
Sequence CACTCTTCCAAGCCTGTACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013782099_1013782100 -8 Left 1013782099 6:113740034-113740056 CCAGGTGGTCTTTGTCACTCTTC No data
Right 1013782100 6:113740049-113740071 CACTCTTCCAAGCCTGTACACGG No data
1013782098_1013782100 -7 Left 1013782098 6:113740033-113740055 CCCAGGTGGTCTTTGTCACTCTT No data
Right 1013782100 6:113740049-113740071 CACTCTTCCAAGCCTGTACACGG No data
1013782096_1013782100 9 Left 1013782096 6:113740017-113740039 CCAAAATGCACTGGGTCCCAGGT No data
Right 1013782100 6:113740049-113740071 CACTCTTCCAAGCCTGTACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013782100 Original CRISPR CACTCTTCCAAGCCTGTACA CGG Intergenic
No off target data available for this crispr