ID: 1013787779

View in Genome Browser
Species Human (GRCh38)
Location 6:113801036-113801058
Sequence AGTTAGGCTTAGACCTTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013787776_1013787779 27 Left 1013787776 6:113800986-113801008 CCTTGCTTTTAGGCATAATTTTA No data
Right 1013787779 6:113801036-113801058 AGTTAGGCTTAGACCTTGACTGG No data
1013787775_1013787779 30 Left 1013787775 6:113800983-113801005 CCACCTTGCTTTTAGGCATAATT No data
Right 1013787779 6:113801036-113801058 AGTTAGGCTTAGACCTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013787779 Original CRISPR AGTTAGGCTTAGACCTTGAC TGG Intergenic
No off target data available for this crispr