ID: 1013788115

View in Genome Browser
Species Human (GRCh38)
Location 6:113805989-113806011
Sequence CTGTTGTTAATACGGACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013788115_1013788119 -1 Left 1013788115 6:113805989-113806011 CCATTTGTCCGTATTAACAACAG No data
Right 1013788119 6:113806011-113806033 GACCTGTTTTGTTTTGTTTGGGG No data
1013788115_1013788118 -2 Left 1013788115 6:113805989-113806011 CCATTTGTCCGTATTAACAACAG No data
Right 1013788118 6:113806010-113806032 AGACCTGTTTTGTTTTGTTTGGG No data
1013788115_1013788117 -3 Left 1013788115 6:113805989-113806011 CCATTTGTCCGTATTAACAACAG No data
Right 1013788117 6:113806009-113806031 CAGACCTGTTTTGTTTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013788115 Original CRISPR CTGTTGTTAATACGGACAAA TGG (reversed) Intergenic
No off target data available for this crispr