ID: 1013788844

View in Genome Browser
Species Human (GRCh38)
Location 6:113813083-113813105
Sequence GAAGCTAGGCTGAGACCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013788839_1013788844 28 Left 1013788839 6:113813032-113813054 CCTTATTTTATATATGAGGAAAC No data
Right 1013788844 6:113813083-113813105 GAAGCTAGGCTGAGACCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013788844 Original CRISPR GAAGCTAGGCTGAGACCTCA TGG Intergenic
No off target data available for this crispr