ID: 1013788863

View in Genome Browser
Species Human (GRCh38)
Location 6:113813305-113813327
Sequence TCTACCTCTTTCCTCCTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013788860_1013788863 30 Left 1013788860 6:113813252-113813274 CCCGGCAACTCAGACTCTGGGTC No data
Right 1013788863 6:113813305-113813327 TCTACCTCTTTCCTCCTCTTAGG No data
1013788862_1013788863 8 Left 1013788862 6:113813274-113813296 CCACAGTTAATACTAATGATTAG No data
Right 1013788863 6:113813305-113813327 TCTACCTCTTTCCTCCTCTTAGG No data
1013788861_1013788863 29 Left 1013788861 6:113813253-113813275 CCGGCAACTCAGACTCTGGGTCC No data
Right 1013788863 6:113813305-113813327 TCTACCTCTTTCCTCCTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013788863 Original CRISPR TCTACCTCTTTCCTCCTCTT AGG Intergenic