ID: 1013788864

View in Genome Browser
Species Human (GRCh38)
Location 6:113813306-113813328
Sequence CTACCTCTTTCCTCCTCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013788861_1013788864 30 Left 1013788861 6:113813253-113813275 CCGGCAACTCAGACTCTGGGTCC No data
Right 1013788864 6:113813306-113813328 CTACCTCTTTCCTCCTCTTAGGG No data
1013788862_1013788864 9 Left 1013788862 6:113813274-113813296 CCACAGTTAATACTAATGATTAG No data
Right 1013788864 6:113813306-113813328 CTACCTCTTTCCTCCTCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013788864 Original CRISPR CTACCTCTTTCCTCCTCTTA GGG Intergenic