ID: 1013790011

View in Genome Browser
Species Human (GRCh38)
Location 6:113825846-113825868
Sequence ACCAGGATGTTGTAGGGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013790011_1013790017 30 Left 1013790011 6:113825846-113825868 CCAATCCCCTACAACATCCTGGT No data
Right 1013790017 6:113825899-113825921 GCATAGAAAGAGACTCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013790011 Original CRISPR ACCAGGATGTTGTAGGGGAT TGG (reversed) Intergenic
No off target data available for this crispr