ID: 1013793590

View in Genome Browser
Species Human (GRCh38)
Location 6:113860094-113860116
Sequence AAGAAGAACAAGAAGGAGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2433
Summary {0: 1, 1: 1, 2: 33, 3: 323, 4: 2075}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013793585_1013793590 15 Left 1013793585 6:113860056-113860078 CCTTCAAGAAGTCTTTCAAGCTG 0: 1
1: 0
2: 0
3: 15
4: 182
Right 1013793590 6:113860094-113860116 AAGAAGAACAAGAAGGAGGCTGG 0: 1
1: 1
2: 33
3: 323
4: 2075

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013793590 Original CRISPR AAGAAGAACAAGAAGGAGGC TGG Exonic
Too many off-targets to display for this crispr