ID: 1013795997

View in Genome Browser
Species Human (GRCh38)
Location 6:113889601-113889623
Sequence CTGGATAAGGAGAAAGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013795995_1013795997 -9 Left 1013795995 6:113889587-113889609 CCTCATCAAAAAAACTGGATAAG No data
Right 1013795997 6:113889601-113889623 CTGGATAAGGAGAAAGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013795997 Original CRISPR CTGGATAAGGAGAAAGATGC TGG Intergenic
No off target data available for this crispr