ID: 1013796557

View in Genome Browser
Species Human (GRCh38)
Location 6:113895421-113895443
Sequence CAGATCTTGGAGAAGTTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013796552_1013796557 3 Left 1013796552 6:113895395-113895417 CCAGAAAGAAGATTAATAAGTAA No data
Right 1013796557 6:113895421-113895443 CAGATCTTGGAGAAGTTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013796557 Original CRISPR CAGATCTTGGAGAAGTTGTG GGG Intergenic
No off target data available for this crispr