ID: 1013799056

View in Genome Browser
Species Human (GRCh38)
Location 6:113919543-113919565
Sequence GGTGACACCACTCTCAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013799048_1013799056 26 Left 1013799048 6:113919494-113919516 CCAGTTCCCTGGCTGCCTGCATT No data
Right 1013799056 6:113919543-113919565 GGTGACACCACTCTCAAGGAGGG No data
1013799050_1013799056 19 Left 1013799050 6:113919501-113919523 CCTGGCTGCCTGCATTGCTGTGT No data
Right 1013799056 6:113919543-113919565 GGTGACACCACTCTCAAGGAGGG No data
1013799051_1013799056 11 Left 1013799051 6:113919509-113919531 CCTGCATTGCTGTGTTTGTTATC No data
Right 1013799056 6:113919543-113919565 GGTGACACCACTCTCAAGGAGGG No data
1013799047_1013799056 29 Left 1013799047 6:113919491-113919513 CCTCCAGTTCCCTGGCTGCCTGC No data
Right 1013799056 6:113919543-113919565 GGTGACACCACTCTCAAGGAGGG No data
1013799049_1013799056 20 Left 1013799049 6:113919500-113919522 CCCTGGCTGCCTGCATTGCTGTG No data
Right 1013799056 6:113919543-113919565 GGTGACACCACTCTCAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013799056 Original CRISPR GGTGACACCACTCTCAAGGA GGG Intergenic
No off target data available for this crispr