ID: 1013802298

View in Genome Browser
Species Human (GRCh38)
Location 6:113961628-113961650
Sequence CCTTACATGGTGACAATACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013802295_1013802298 -10 Left 1013802295 6:113961615-113961637 CCATAAAGCTCTACCTTACATGG 0: 1
1: 0
2: 0
3: 7
4: 96
Right 1013802298 6:113961628-113961650 CCTTACATGGTGACAATACAAGG 0: 1
1: 0
2: 1
3: 10
4: 86
1013802294_1013802298 9 Left 1013802294 6:113961596-113961618 CCTATTAAGAAAGAATCTACCAT 0: 1
1: 0
2: 2
3: 16
4: 209
Right 1013802298 6:113961628-113961650 CCTTACATGGTGACAATACAAGG 0: 1
1: 0
2: 1
3: 10
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013802298 Original CRISPR CCTTACATGGTGACAATACA AGG Intronic
901350061 1:8587327-8587349 CCTTACAAGGGAACACTACAAGG + Intronic
903082156 1:20819624-20819646 AGCTAAATGGTGACAATACATGG + Intronic
913289298 1:117257871-117257893 CTTTACATGGTGACAAGAGGGGG + Intergenic
913348218 1:117829138-117829160 CCTTACATGGTGAAAGAACAAGG + Intergenic
924317465 1:242813312-242813334 CCTCACATGATTAGAATACAGGG + Intergenic
924398984 1:243657191-243657213 TTTTACTAGGTGACAATACAGGG + Intronic
924814050 1:247427154-247427176 CCTTACATGGTGAAGAGGCAAGG + Intronic
1065388406 10:25157007-25157029 CCTCACATGGTGGCAAGGCATGG - Intergenic
1066548745 10:36532201-36532223 CCCTACATGGTGTCAAAACGTGG + Intergenic
1071547804 10:86541570-86541592 CCTTACTTTCTGACACTACAAGG - Intergenic
1074929498 10:118109334-118109356 CCTTCCATGCTGAAAATACCAGG - Intergenic
1076318390 10:129559924-129559946 CCTTCCATGCTGACCATCCAAGG - Intronic
1079670899 11:23169695-23169717 CCTCTCAGGGTGGCAATACAGGG + Intergenic
1080108193 11:28534590-28534612 TCTTACATATTTACAATACAAGG + Intergenic
1083396627 11:62396987-62397009 CCCTGCAAGGTGACAATCCAGGG - Intergenic
1085398948 11:76224106-76224128 CCTTACATGGTGTGACTACATGG - Intergenic
1093412664 12:18884954-18884976 CCTTACATGGAGAAAAGACCAGG + Intergenic
1094056848 12:26277011-26277033 CCCTACATGTGGACACTACATGG - Intronic
1100064443 12:90624525-90624547 CCTTACATTGGGACAATATGTGG + Intergenic
1101189347 12:102315294-102315316 CTTTACCTGGTGAAAATACATGG - Intergenic
1102638992 12:114349635-114349657 TCTTACATGGTGGGAGTACAGGG - Intergenic
1119622547 14:76142606-76142628 TCTTACATGGTCACAACTCATGG + Intergenic
1121272205 14:92645264-92645286 CCTGAAATGCTGACTATACAAGG - Intronic
1123715119 15:23022754-23022776 CCTTACATAGTGACAGTACATGG - Intronic
1125330212 15:38574835-38574857 GCTTACCTGGTGAAAATAGATGG - Intergenic
1128395275 15:67218725-67218747 CCTTTCATGATGACAATAAAGGG + Intronic
1129885742 15:79035931-79035953 CGTTACGTGGCGACAAAACAGGG - Intronic
1138136713 16:54529748-54529770 CCTTTTACGGTGACAAAACAGGG - Intergenic
1140047478 16:71451560-71451582 CCTCACATGGTGGCAAGAAAGGG - Intronic
1141388325 16:83643634-83643656 CCTTTCTTGGTGGCAATAAAGGG + Intronic
1145695232 17:26782167-26782189 CCTAACATGCTGACATCACAAGG - Intergenic
1151299087 17:73208693-73208715 CCTTAATTGTTGACACTACAAGG + Exonic
1156041585 18:32829139-32829161 TCTCAGATGGTGACAAGACAAGG + Intergenic
1157292024 18:46416437-46416459 TGTTGCATGGAGACAATACAGGG + Intronic
1158857408 18:61556702-61556724 CATTACATGGTACCATTACATGG + Intergenic
1159233320 18:65637046-65637068 CTTTACCTGGTGACAGTATATGG - Intergenic
1159697657 18:71580700-71580722 CCTTACGTAGTGACAATTTAAGG + Intergenic
1164948881 19:32319295-32319317 ACTTACAGGGTGATAATAAAAGG + Intergenic
931612453 2:64116995-64117017 CCTTATATGGACACAATTCAGGG - Intronic
936437294 2:112519606-112519628 CTTTACATGGCAAAAATACATGG + Intronic
938003212 2:127763469-127763491 CCTTAAGTGGTGAAAATAAATGG + Intronic
944400278 2:199318106-199318128 CCTTACATGTTGAATATAAATGG + Intronic
946296917 2:218791815-218791837 CTTTTCCTGGTGAAAATACACGG + Intronic
947786297 2:232824034-232824056 CCTTACATGGGCACAGTTCACGG - Intronic
947795708 2:232892801-232892823 CCTTACACGGTGACACTTCATGG - Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170015033 20:11770818-11770840 CCTTTCATGATTACAATAGAGGG - Intergenic
1171577025 20:26340921-26340943 CCTTCCTTGGTGACATTGCAAGG + Intergenic
1180024028 21:45148376-45148398 CCTTCAATGCTGACAATACTGGG - Intronic
1183172107 22:36196087-36196109 CCGTACATGGGGAGAAAACATGG - Intronic
1185093603 22:48792211-48792233 CCTTACAAGGTAACATTTCATGG + Intronic
957336729 3:78839707-78839729 CCTTACATAGTGACAAGGCTGGG - Intronic
957719045 3:83970469-83970491 CTTTACCTGGTGAAAATACAAGG - Intergenic
958603059 3:96323854-96323876 CCATCCATTGTGACAATACATGG + Intergenic
970823311 4:20244764-20244786 CCTTCCTTGGTGACATTGCAAGG - Intergenic
971421693 4:26479371-26479393 GCTAAAATGGTGACAATAAAGGG - Intergenic
978067664 4:104425431-104425453 CCTTCCAGAGTGACTATACAAGG - Intergenic
984978008 4:185247532-185247554 CCTTACATGCAAACAAAACATGG - Intronic
986303527 5:6497893-6497915 CCTTTCACGTTGACAATTCAAGG + Intergenic
989692888 5:44166607-44166629 CTTCACATGGTGACAGTAGAGGG + Intergenic
993233787 5:85276049-85276071 CATCACATGGTGAAAAGACAAGG - Intergenic
998659090 5:144216172-144216194 CCTTTCATGGTGACAGAAAATGG + Intronic
999872229 5:155764698-155764720 CCATTCATGGGGACAGTACATGG + Intergenic
1004924900 6:20406657-20406679 CCTTGAATTGTGACAATTCAAGG + Intronic
1008055892 6:46945858-46945880 TCTTACATGGTGGCAGTAAAGGG + Intronic
1008396345 6:51012047-51012069 CCTTACTTCCTGACACTACAAGG + Intergenic
1011123674 6:83983250-83983272 CTTTACCTGGTGAAAATACATGG - Intergenic
1012509349 6:99984753-99984775 CCTTAGAATGGGACAATACAAGG + Intronic
1012613888 6:101251616-101251638 CCTTACATGGTTAAAAGAGAAGG - Intergenic
1013802298 6:113961628-113961650 CCTTACATGGTGACAATACAAGG + Intronic
1015248060 6:131097482-131097504 AGTTAAATGGTGAGAATACATGG + Intergenic
1015473732 6:133635767-133635789 CAATAGATGGTGACAAAACACGG + Intergenic
1020546094 7:9533410-9533432 CATCAAATGGTGAAAATACATGG - Intergenic
1023900229 7:44471078-44471100 CCTTGCATGGTGACGACAAATGG + Intronic
1024598100 7:50956580-50956602 ACTTACATGAAGACAACACAAGG + Intergenic
1026902973 7:74047191-74047213 CCTTGGCTGGTGACCATACAGGG - Intronic
1031717981 7:125132561-125132583 ACTTACAGGGTGACCATAAAAGG - Intergenic
1032006608 7:128306880-128306902 GCTTACTTGGTGACCAGACATGG - Exonic
1033561999 7:142541232-142541254 ACTTACATGGTGCCTACACACGG - Intergenic
1034876551 7:154729720-154729742 GCTTCCATGGTGACCACACAGGG - Intronic
1044003368 8:86912824-86912846 CCTTCCAGGGGGACAAGACATGG + Intronic
1044531833 8:93316230-93316252 ACTTTCATGGTGACACTAGAAGG + Intergenic
1048155312 8:131942488-131942510 CATTACATGATGACAAAACAAGG - Intronic
1049650725 8:143767534-143767556 TCTTACATAGAGACAGTACAAGG + Intergenic
1052670723 9:31553670-31553692 CCATAAATGGAGACAAGACAGGG + Intergenic
1059680671 9:116582351-116582373 CCTTTCATGGGGAAGATACATGG - Intronic
1185673549 X:1830723-1830745 CCTTACATGGCGGCCTTACATGG + Intergenic
1185776821 X:2809847-2809869 CATCACATGGTGACCAGACAGGG + Intronic
1187576383 X:20560857-20560879 CCTCACATGGTGGAAATAAAAGG - Intergenic
1189348161 X:40258165-40258187 CCTGACATGGTGACATTTCAGGG + Intergenic
1193958781 X:87897515-87897537 CTTTACCTGATGAAAATACACGG + Intergenic
1195730797 X:107964998-107965020 CTTTATATGGTGACTCTACATGG - Intergenic
1196286898 X:113893288-113893310 CCTTACATTTTGGCAGTACAGGG + Intergenic
1198257627 X:134938402-134938424 CCTTACAGGGTTAGAATAGAGGG - Intergenic
1199616516 X:149659975-149659997 CCTTACATGCTGACATACCAGGG + Intergenic
1199626125 X:149743273-149743295 CCTTACATGCTGACATACCAGGG - Intergenic
1201220953 Y:11769826-11769848 CCTCACATGATTAAAATACAGGG + Intergenic
1202043554 Y:20713181-20713203 CTTTACCTGGTGAAAATACGTGG + Intergenic