ID: 1013807353

View in Genome Browser
Species Human (GRCh38)
Location 6:114010685-114010707
Sequence CTGTCTACACACAGGGATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013807349_1013807353 5 Left 1013807349 6:114010657-114010679 CCTGAAACTTGTGCGGGTTTGCT 0: 1
1: 1
2: 2
3: 8
4: 63
Right 1013807353 6:114010685-114010707 CTGTCTACACACAGGGATCAGGG 0: 1
1: 0
2: 3
3: 10
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013807353 Original CRISPR CTGTCTACACACAGGGATCA GGG Intronic
902123966 1:14192977-14192999 CTTTTGACACACAGGGATTATGG - Intergenic
902397295 1:16139254-16139276 CTGCCCAGACACAGGGCTCACGG + Intronic
903337987 1:22637598-22637620 GTGTCTCCACAGAGGCATCATGG + Exonic
905510794 1:38518135-38518157 GTGAGCACACACAGGGATCAAGG - Intergenic
909318285 1:74251109-74251131 CTCTCTGCACAGAGGCATCATGG - Intronic
911327717 1:96488531-96488553 CTGACCACACACAGGGCTCTAGG + Intergenic
915268101 1:154733002-154733024 CTGTCTCCTCACTGGCATCATGG - Exonic
918254804 1:182739661-182739683 CTGTCTACATACACAAATCAGGG - Intergenic
919366746 1:196670406-196670428 CCCTCAACACACAGGGATTATGG - Intronic
920947450 1:210542989-210543011 CTGTTCACAGACAGGCATCATGG + Intronic
921505617 1:215965408-215965430 TTGTCAAAACACAGGGATCCCGG - Exonic
921616771 1:217277600-217277622 CTGTTGACACACAGGGATTATGG - Intergenic
1063629515 10:7720967-7720989 CTGGCAACACACAGGGCTCAGGG - Intronic
1066443088 10:35457448-35457470 CTGTCCAGACACAGGAAACACGG - Intronic
1068871250 10:61947749-61947771 CTGTCTACACTCAGCCATCTTGG + Intronic
1074156997 10:110808012-110808034 CTGCCTTCACACAGGCACCAGGG - Intronic
1075612597 10:123865634-123865656 CTGGCTGCCCACTGGGATCAGGG + Intronic
1075769247 10:124919062-124919084 CAGTGTACAGACATGGATCAAGG - Intergenic
1077673870 11:4180986-4181008 CTGGCTACAGGCAGGGGTCAGGG - Intergenic
1077847737 11:6043791-6043813 CTGTCTTCTCACTGGGCTCATGG + Intergenic
1078550848 11:12279718-12279740 CTGTCTCCACACATGGAACTCGG + Intronic
1079326725 11:19499366-19499388 CTGACCCCACACAGGGGTCAAGG + Intronic
1080847149 11:36036423-36036445 CTGTGTAGACACAGGGATCTTGG + Intronic
1084438033 11:69155463-69155485 GTGTCCACACGCAGGGGTCAAGG - Intergenic
1089900737 11:121981024-121981046 CTGTGTACACAAGGGGATCTTGG + Intergenic
1094799685 12:34018802-34018824 CTGTTGACACATGGGGATCATGG + Intergenic
1096242929 12:49968854-49968876 CTAACTACACACAGGGAGGAGGG + Intronic
1098636123 12:72785847-72785869 CTCTCTCCACACAGGCAACAAGG - Intergenic
1098643571 12:72868968-72868990 CTATCTAAACACATGGATTAAGG - Intergenic
1099079722 12:78161739-78161761 CTGTATACACACAACAATCATGG + Intronic
1107640876 13:42441907-42441929 CTGTATACACACAGCCAACAAGG + Intergenic
1112407907 13:99137086-99137108 CTGTATACACACAGGAGTGAAGG + Intergenic
1112809141 13:103197440-103197462 TTGTCTACAGACAGGAGTCAGGG - Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114009087 14:18348273-18348295 CTGTATCCTCACAGGGCTCAGGG + Intergenic
1118459602 14:65976241-65976263 CTGTCTATGCACAGGGGACAAGG + Intronic
1118626115 14:67660879-67660901 ATGGCTACAAACAGGTATCATGG + Intronic
1121690392 14:95874163-95874185 CTGTGTGGCCACAGGGATCATGG + Intergenic
1123392284 15:19888876-19888898 CTGTATCCTCACAGGGCTCAGGG + Intergenic
1126979547 15:54226806-54226828 GTGTCTGGACAGAGGGATCATGG + Intronic
1128741902 15:70089517-70089539 CTTCCTACTCACAGGGCTCAGGG + Intronic
1128914525 15:71547543-71547565 CTATCTACCAAGAGGGATCAGGG + Intronic
1132384986 15:101393951-101393973 CTGTCTTCACGCAGAGTTCATGG - Intronic
1132944897 16:2527415-2527437 CTGTCCCCTCACAGGGGTCAGGG - Intronic
1133647126 16:7774993-7775015 TTTTCTACCCACACGGATCATGG + Intergenic
1134466517 16:14483651-14483673 CTGTCTAAAAACAGGCATGAGGG - Intronic
1134808699 16:17148131-17148153 CTGTCAAGACACAGGTGTCATGG - Intronic
1135139888 16:19912244-19912266 CTGCCTACACACTGGGATCACGG - Intergenic
1136270923 16:29147820-29147842 CTGTCTCCTCCCTGGGATCAGGG + Intergenic
1137701552 16:50501491-50501513 CTGCCTGCACACAGGGCTCATGG - Intergenic
1137701678 16:50502264-50502286 CTGTCTGCATACAGGGCTCATGG + Intergenic
1138412288 16:56850246-56850268 CTGGCTACAGACAGGGATAGTGG - Intronic
1140972506 16:80027265-80027287 CTCTATTCAGACAGGGATCAGGG - Intergenic
1141805906 16:86341343-86341365 CTGTGGACACACAGGGAGCGCGG + Intergenic
1142074537 16:88109844-88109866 CTGTCTCCTCCCTGGGATCAGGG + Intronic
1142215100 16:88826166-88826188 CGGGCTACAGACAGGGAACAGGG + Intronic
1142270248 16:89085256-89085278 ATGTCAACACACAGGAAACACGG + Intergenic
1142275639 16:89117511-89117533 CTGTCTACACCCAGGGAGTCAGG + Intronic
1149580381 17:57745946-57745968 CTCACTACACACTAGGATCAGGG + Intergenic
1149646644 17:58246082-58246104 CACTCTAGGCACAGGGATCAGGG + Intronic
1155072796 18:22330917-22330939 CTGTCTCCACAAAGAGAGCAAGG + Intergenic
1156030256 18:32704849-32704871 CTGTCTACACAGTGGGCTCTGGG - Intronic
1156221909 18:35061422-35061444 CTGACTTCACACAAGGATGATGG - Intronic
1164481348 19:28613358-28613380 CTGTTTTCCAACAGGGATCAAGG - Intergenic
926988250 2:18647851-18647873 GAGTCTACAAACAGGGACCAGGG - Intergenic
927091842 2:19718314-19718336 CTGTCTATACACACAGATAATGG - Intergenic
928087916 2:28357098-28357120 CTGCCCTCACACAGGCATCATGG + Intergenic
928268915 2:29837019-29837041 CTGTGTTCACAGTGGGATCAGGG - Intronic
929059987 2:37914122-37914144 CTGTCCACACCCAGGGTACAAGG - Intergenic
931198279 2:60073621-60073643 CTTTCGAAACACAGGGATTAGGG - Intergenic
932092075 2:68815171-68815193 ATGTCTACACACAGGGACCAAGG + Intronic
941169625 2:162120771-162120793 ATGTGTACACACATGCATCAGGG + Intergenic
943034231 2:182721065-182721087 TTGTAAACACACAGGTATCAAGG + Intronic
944897834 2:204183615-204183637 ATATGTACACACAAGGATCAAGG - Intergenic
947404303 2:229758387-229758409 CTCTCAACTCACAGGAATCATGG + Intergenic
1169034190 20:2436235-2436257 CTGTCTTCACCCAGTGACCAGGG - Intergenic
1170710900 20:18789758-18789780 CAGTCAAGACAGAGGGATCAGGG + Intergenic
1170794171 20:19532183-19532205 CTGGCTGCATACAGGAATCAAGG - Intronic
1175772789 20:61634247-61634269 CTGTCCACACACAGGAAGGAGGG - Intronic
1178724115 21:35036054-35036076 CTGTCTTCCCTCAGGGATAATGG - Intronic
1179577607 21:42317676-42317698 CTGCCTACACCCAGGGTTTAGGG + Intergenic
1180433586 22:15279083-15279105 CTGTATCCTCACAGGGCTCAGGG + Intergenic
1182334822 22:29576958-29576980 GTGACTTCACTCAGGGATCAGGG + Intronic
1182521797 22:30889038-30889060 CTGTCTACACACAGAACACACGG + Intronic
1183717109 22:39539970-39539992 CTGGCTTCCCAGAGGGATCAAGG - Intergenic
1184346378 22:43916029-43916051 CTGTGTCCTCACACGGATCAAGG - Intergenic
950242835 3:11387169-11387191 CTGTCCACACACAGGTATAATGG + Intronic
950660598 3:14464589-14464611 GTTTCTACTCAAAGGGATCATGG + Intronic
952304111 3:32130216-32130238 CTGTCCACACCCAGTGACCAGGG - Intronic
952699603 3:36312046-36312068 CTCTCCACACACAGGTACCAAGG + Intergenic
954626721 3:52025889-52025911 CTGTCTAGACCCAGGGCTCCTGG - Intergenic
957167127 3:76689814-76689836 CTGACTACACACAGAGAGAACGG - Intronic
961557922 3:127709348-127709370 CTGGCTCCACACAGGCCTCATGG + Intronic
962421463 3:135232978-135233000 ATTACAACACACAGGGATCATGG + Intronic
962832853 3:139159315-139159337 TTTTCTAGACACTGGGATCATGG + Intronic
963081729 3:141401651-141401673 CTGTCAAAACACAGGGAACATGG + Intronic
964377233 3:156060303-156060325 CTGGCTACACTCAGGGAATAGGG + Intronic
968943359 4:3650976-3650998 CTGTCTGCACGCAGGGATGCCGG - Intergenic
974563725 4:63555665-63555687 CTCTCTACACATAAGGATTATGG + Intergenic
976416083 4:84777048-84777070 CTGTTTATACACAGGGAAGAAGG + Intronic
977970036 4:103202249-103202271 CTTTGTACACACAGGGGACAAGG - Intergenic
991484641 5:67122024-67122046 GTGTCTACAAAAAGGGATCAAGG - Intronic
992350642 5:75925340-75925362 CTGTTTACACACTGGGGCCAAGG - Intergenic
992734898 5:79709081-79709103 TTTTCTACAAACAGGTATCAAGG + Intronic
993877453 5:93324832-93324854 CTGTCTACACATGGGTATCTTGG + Intergenic
994611073 5:102040356-102040378 CTCTATACACACAAGGATGATGG + Intergenic
997232185 5:132253279-132253301 CTTTCTACACCCAGGCCTCAGGG + Intronic
998031179 5:138869579-138869601 CTTCCTACACACAGCTATCAGGG - Exonic
998097152 5:139402563-139402585 CTGCCTAACCACAGGGATCCTGG + Intronic
998447846 5:142212083-142212105 CTGGCCACTCACAGGGATCCTGG - Intergenic
1000279041 5:159766284-159766306 CTGTCTACTAACTGAGATCAAGG + Intergenic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1004417696 6:15439549-15439571 CTGTCTACAGACAAGGAAAATGG + Intronic
1004601032 6:17150153-17150175 CTGTCCTCACACAGGCATGACGG + Intergenic
1005144817 6:22676995-22677017 CTGATTACATACAGGGATAAAGG + Intergenic
1005352681 6:24951836-24951858 CTTTCTACACACTGGGATGAGGG + Intronic
1013807353 6:114010685-114010707 CTGTCTACACACAGGGATCAGGG + Intronic
1015981958 6:138848144-138848166 CCCTCGACACACAGGGATTATGG + Intronic
1016002180 6:139053013-139053035 CTGACTACACACAGAGATCAAGG - Intergenic
1017064807 6:150518952-150518974 CTGTCTCCAAATAGGGAACAGGG + Intergenic
1021842163 7:24729613-24729635 CTGTCTGCACAGAGGCATGAAGG - Intronic
1022411355 7:30141004-30141026 CTGTGGTCACACAGGGAACAAGG - Intronic
1023336616 7:39177272-39177294 CTGCCTTCACACAGAGTTCAGGG + Intronic
1023726919 7:43152096-43152118 TTGTCTACACAAAGGAATCCAGG - Intronic
1026850206 7:73719197-73719219 CTGTCTACACCGAGGGGGCACGG + Intronic
1032171045 7:129584856-129584878 CTGTTTTCCAACAGGGATCAAGG - Intergenic
1032595899 7:133239772-133239794 CTGTCTATTAACAGGGATTATGG + Intergenic
1035417621 7:158703895-158703917 GTGCCTACACCCAGGGCTCAGGG + Intronic
1036133735 8:6140083-6140105 CTGTTTACACAAAGGGAATAGGG - Intergenic
1036704378 8:11035724-11035746 CTGCCTCCTCACAGGGATGATGG - Intronic
1037482979 8:19322272-19322294 CTGTCAACCCACAAGGGTCATGG - Intronic
1041522250 8:58769536-58769558 CTTTCCACACTCAGGCATCAAGG - Intergenic
1042875838 8:73439282-73439304 CTGCCTTCACACAGGATTCAGGG - Intronic
1050440535 9:5657776-5657798 CTGTGTACAAACAGGCACCAGGG - Intronic
1051146851 9:14035811-14035833 CTGTTGACACATAGGGGTCAGGG + Intergenic
1056667090 9:88589641-88589663 CTGTGCACACACAGGGTACAGGG + Intergenic
1057044005 9:91870363-91870385 CAGGGTACACACCGGGATCAGGG + Intronic
1061250503 9:129423523-129423545 CAGTCATGACACAGGGATCAGGG - Intergenic
1200814953 Y:7521897-7521919 CTCTCTACACATGGGGATCATGG - Intergenic