ID: 1013808456

View in Genome Browser
Species Human (GRCh38)
Location 6:114018291-114018313
Sequence ACAAAGGAATGAGAAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 779
Summary {0: 23, 1: 18, 2: 19, 3: 67, 4: 652}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013808456_1013808467 20 Left 1013808456 6:114018291-114018313 CCTGTCTCTTCTCATTCCTTTGT 0: 23
1: 18
2: 19
3: 67
4: 652
Right 1013808467 6:114018334-114018356 CCTACGAGTGGTGTTGAGGCTGG No data
1013808456_1013808460 -6 Left 1013808456 6:114018291-114018313 CCTGTCTCTTCTCATTCCTTTGT 0: 23
1: 18
2: 19
3: 67
4: 652
Right 1013808460 6:114018308-114018330 CTTTGTTGCCACCGGACTTCGGG No data
1013808456_1013808459 -7 Left 1013808456 6:114018291-114018313 CCTGTCTCTTCTCATTCCTTTGT 0: 23
1: 18
2: 19
3: 67
4: 652
Right 1013808459 6:114018307-114018329 CCTTTGTTGCCACCGGACTTCGG 0: 3
1: 7
2: 14
3: 15
4: 102
1013808456_1013808464 16 Left 1013808456 6:114018291-114018313 CCTGTCTCTTCTCATTCCTTTGT 0: 23
1: 18
2: 19
3: 67
4: 652
Right 1013808464 6:114018330-114018352 GTACCCTACGAGTGGTGTTGAGG No data
1013808456_1013808463 8 Left 1013808456 6:114018291-114018313 CCTGTCTCTTCTCATTCCTTTGT 0: 23
1: 18
2: 19
3: 67
4: 652
Right 1013808463 6:114018322-114018344 GACTTCGGGTACCCTACGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013808456 Original CRISPR ACAAAGGAATGAGAAGAGAC AGG (reversed) Intergenic
900081229 1:859056-859078 AAAAAGGAATAAGAAGAGGTCGG + Intergenic
900718421 1:4159779-4159801 CCCAAGGAATGGGAAGAGAGTGG + Intergenic
900803505 1:4752216-4752238 ACAGGGGGATGAGAAGACACTGG + Intronic
901336659 1:8455024-8455046 ATATAGGAAAGAGAAGAGCCTGG + Intronic
901714752 1:11144426-11144448 AGAAGAGAATAAGAAGAGACTGG + Intronic
902956410 1:19926920-19926942 CCAAAGAAATGAGAAAAGACAGG + Intergenic
902956998 1:19932212-19932234 ACAAAGGAATGAGAAAAGACAGG + Intergenic
903793975 1:25914280-25914302 ACACAGGAATGAGAAGAGAAGGG + Intergenic
904041584 1:27588281-27588303 ACAATGGAGTTGGAAGAGACAGG + Intronic
904242427 1:29156783-29156805 ACGAAGGAATGAGAAGAGAGAGG + Intronic
904583362 1:31564371-31564393 ACAAATGAAGCAGAAGGGACAGG - Intergenic
904884160 1:33724030-33724052 TCAAAGGGATGAGAAGACTCTGG + Intronic
905524489 1:38625872-38625894 AGAAAGGACTCAGAAGAAACTGG + Intergenic
905634383 1:39539664-39539686 AAAAAGAAATGAAAAGTGACAGG - Intergenic
905925508 1:41746731-41746753 GCAAGGAAATGACAAGAGACAGG - Intronic
906149447 1:43579029-43579051 AAGCAGGAAGGAGAAGAGACTGG - Intronic
906657985 1:47562524-47562546 ACACTGGAAAGAGAAGTGACTGG - Intergenic
907097535 1:51795421-51795443 ACAAAGGGAAGAGAAGAAATAGG - Intronic
907577191 1:55537528-55537550 AGCAAGGAAAGAGTAGAGACTGG + Intergenic
907957965 1:59249605-59249627 AGAGTGGAATGAGAAGAGAGTGG + Intergenic
907963510 1:59306606-59306628 TCAAAGGAAGGAGAAGAGTAAGG - Intronic
909103276 1:71377790-71377812 AAAACAGAATGTGAAGAGACTGG + Intergenic
909255804 1:73419924-73419946 CCAAAGGAATTTAAAGAGACAGG + Intergenic
909919884 1:81367846-81367868 AAAAAGGAATGAGATCAGGCTGG - Intronic
910078743 1:83313327-83313349 AGAAGAGAATGAGAAGAAACAGG + Intergenic
910252898 1:85216796-85216818 AAAAAAGAATGAGAAAAGAAAGG + Intergenic
910327217 1:86024074-86024096 ACAATGGAAGGAAAGGAGACTGG - Intronic
910927111 1:92409018-92409040 ATGATGGAATGAGAAGAGGCTGG + Intergenic
911063044 1:93764252-93764274 AGGAAGGAATGAGAAGAGATGGG - Intronic
911287801 1:96018618-96018640 ACAAAGAAAGGAGGAGAGAAAGG - Intergenic
911353208 1:96781428-96781450 AAAAAGGCATGAGAGGAGAATGG - Intronic
911667868 1:100574548-100574570 AAAAAGGAATGAGAAAAAAGGGG + Intergenic
911827286 1:102503338-102503360 ATAAAGTAAGGAGAAGAGGCAGG - Intergenic
914249683 1:145911489-145911511 ACAAAGGAGTAAGAACAGACTGG + Exonic
914860888 1:151385137-151385159 TCAAAGGAATGAGAAGTAAAAGG + Intergenic
915079916 1:153345086-153345108 GAAAAGGGATGAGAAGGGACAGG + Intronic
915117864 1:153611769-153611791 ACACAGGAAGGAGCAGAGAATGG - Intronic
915409828 1:155691881-155691903 ACAAAGGAATGAGAAGAGACAGG + Intronic
915410632 1:155699030-155699052 ACAAAGGAATGAGAAGAGACAGG + Intronic
915536500 1:156539336-156539358 ACAAAGGAATGGGGAGAGAATGG - Intronic
915625752 1:157113163-157113185 ACACAGGAAGGAAAAGAGATGGG + Intergenic
915779825 1:158535072-158535094 ACGAAGGAATGAGAAGAGACAGG - Intergenic
915913721 1:159929279-159929301 AAAAAGGAAGCAGAAGATACTGG + Intronic
916214415 1:162383402-162383424 ACCATGGAAAGAGAAGAGAGAGG + Exonic
916268035 1:162911421-162911443 ACAAAGGAACAAGGAGAGATTGG - Intergenic
916437282 1:164788763-164788785 ACAAAAGAATGAAAAGAAAAGGG - Intronic
917328035 1:173853422-173853444 CCAAAGGAAAGAGAACAGAGTGG - Exonic
917561316 1:176159837-176159859 AGAAGGGAATGAGATGAGAGGGG + Intronic
917668055 1:177244893-177244915 ACAAAGGAATGAGGGCAGAAGGG - Intronic
917738193 1:177939117-177939139 ACACAGGGCTGGGAAGAGACGGG + Intronic
918543284 1:185654510-185654532 AAAAAGGAAAGAGGAGAGAAAGG - Intergenic
919065735 1:192690937-192690959 AGAAAGAAATGAGTAGACACTGG + Intergenic
920070796 1:203301597-203301619 ACCAAGGAATGGGAAGCAACAGG + Intergenic
920304732 1:205011226-205011248 ACAAAGGAAATAGAAGGGAGAGG + Intronic
920544481 1:206804026-206804048 AGAAAGGGAAGGGAAGAGACAGG - Intronic
920553281 1:206883269-206883291 GCGAAGGAATGGGAAGAGTCAGG + Intergenic
920792195 1:209103902-209103924 GGGAGGGAATGAGAAGAGACAGG - Intergenic
920798411 1:209162972-209162994 CCAAAGGAATTAGATGAGAAAGG + Intergenic
920881234 1:209882255-209882277 ACAAAAGAATTATTAGAGACAGG - Intergenic
920974543 1:210773553-210773575 ACAAAGGACTTAGAAGACAAAGG + Intronic
921194808 1:212745232-212745254 AGAAGGGGAAGAGAAGAGACAGG + Intronic
921215376 1:212932474-212932496 ACAAAGCAATGGGAGGAAACAGG + Intergenic
921292505 1:213671535-213671557 ACAAAGAAATGATACGAGGCGGG + Intergenic
922022793 1:221721228-221721250 ACACTGGAATGAGATGAGATAGG + Intronic
922042576 1:221911126-221911148 ATAAAGAAATGAAAATAGACTGG + Intergenic
922433961 1:225584491-225584513 ACAAAGGACTGAAAACAGAAGGG + Intronic
922596825 1:226820330-226820352 CCCAAGAAATGAGAAGGGACAGG + Intergenic
922949021 1:229542670-229542692 ACAACAGAGTGGGAAGAGACAGG + Intronic
922953942 1:229583365-229583387 AAGAAGGAAAGAAAAGAGACAGG - Intergenic
923106114 1:230855334-230855356 CCAGAGGTATGAGCAGAGACAGG + Intronic
923254774 1:232212008-232212030 AGAAAGGAAAGAAAAGAAACTGG + Intergenic
923415210 1:233749823-233749845 ACAAATGAATAAGAAGGGACAGG + Intergenic
923578624 1:235185810-235185832 ACAAAGGAATGAGAAACCAAAGG - Intronic
924206610 1:241718480-241718502 ACAAAGGTATCAGAAGAGAAGGG + Intronic
924507260 1:244697489-244697511 AAAAAGGACTGAGAAAAGAAAGG + Intronic
1062872875 10:921833-921855 ACAAAGAAATGGGAAGAGCAGGG + Intronic
1063273600 10:4539252-4539274 ACAAAGAAAAGAAAAGAGAAAGG + Intergenic
1063291384 10:4753460-4753482 ACAGAGGGATGTGAAGGGACAGG + Intergenic
1063348322 10:5332420-5332442 AGGAGGGAATGAGGAGAGACTGG - Intergenic
1063516872 10:6705251-6705273 GCAAAGGAATAAGAAGAAACAGG - Intergenic
1063951966 10:11231803-11231825 AGAGGGGAAAGAGAAGAGACAGG - Intronic
1064712788 10:18143434-18143456 ATAAAGGAGAGAGAAGAGAAAGG + Intronic
1065371268 10:24989077-24989099 ACAAAGAACTTAGAAGTGACAGG - Intronic
1066480607 10:35792174-35792196 AGGAAAGAATGAGAAGAGAAAGG + Intergenic
1066654466 10:37685643-37685665 ATGAAGGAATGAGAAGAGACAGG - Intergenic
1067538796 10:47136714-47136736 AGAAAGGAAAGAAAAGAGGCAGG - Intergenic
1068075513 10:52248898-52248920 AGAAAGGAAAGAAAAGAGAAAGG - Intronic
1069065021 10:63933323-63933345 CCCAAGGCATTAGAAGAGACAGG - Intergenic
1069920724 10:71813909-71813931 AAAAAGGAAAGAAAAGAAACTGG + Intronic
1070596707 10:77837835-77837857 ACAAAGGCGTGGGAAGAGATGGG + Intronic
1071092581 10:81936202-81936224 TCAAAAGATTGAGAAGAGGCTGG + Intronic
1071465661 10:85937493-85937515 ACATAAGACTGAGATGAGACAGG - Intronic
1071775880 10:88787321-88787343 ACAAAGGAACTAAAAGGGACAGG - Intergenic
1071905662 10:90170816-90170838 ACCAACAAATGAGAAGAGTCTGG + Intergenic
1071917611 10:90313011-90313033 AGAAAGGAAAGAGAAAAGAAAGG - Intergenic
1071945319 10:90637468-90637490 ATAGAGGAATGAGAAGGGAGGGG + Intergenic
1073020931 10:100443269-100443291 CCAGACAAATGAGAAGAGACAGG - Intergenic
1073779808 10:106824892-106824914 ACACAGAAATGAGAAAAAACTGG + Intronic
1074204869 10:111274314-111274336 GGAAAGGATTGAGAAAAGACGGG - Intergenic
1074585177 10:114761549-114761571 AGAAAGGGATGAGAAGGGAGAGG - Intergenic
1075479003 10:122763386-122763408 TCAAAGGAATGAGAAAAGACAGG + Intergenic
1076173566 10:128344933-128344955 ACAAAGGAAGGAGAAGGGAAAGG - Intergenic
1076360631 10:129886468-129886490 ACAAAGGGAGGTGAAGAGAGAGG - Intronic
1076815433 10:132912340-132912362 AGAAAGAGAGGAGAAGAGACAGG - Intronic
1076940545 10:133604082-133604104 TCAAAGGAATGAGAAAAGACAGG - Intergenic
1078843930 11:15105098-15105120 TCAGAGGAAGGAGCAGAGACAGG + Intergenic
1078893297 11:15576846-15576868 AGGTAGGAATGAGGAGAGACTGG - Intergenic
1079704392 11:23595746-23595768 ACAAAGGAACCAGAAGGTACAGG + Intergenic
1080285582 11:30607584-30607606 ACAAATGAATGAGAAAGGATAGG - Intergenic
1080555184 11:33409628-33409650 ATAAATGAGTGAGAAGAGAAAGG - Intergenic
1080594728 11:33761144-33761166 AAAAAGAAAGGAGAAGAGAATGG + Intronic
1081403449 11:42668838-42668860 ATAAAGGAAGAGGAAGAGACAGG + Intergenic
1081678051 11:44982462-44982484 ACAAAGGACTTAGAAGAGGTAGG - Intergenic
1082707484 11:56510182-56510204 ACTAAGGAAGAAGAAGAGAAAGG + Intergenic
1083010451 11:59392318-59392340 AAAAAGGAATGAGAAGGAAATGG + Intergenic
1085865076 11:80281418-80281440 CCAAACTACTGAGAAGAGACAGG + Intergenic
1086089767 11:82993621-82993643 ACAAGGATATGAGAGGAGACAGG + Intronic
1086396458 11:86421014-86421036 ATAAAGGACTGAGGAGACACAGG + Intronic
1086595898 11:88570034-88570056 ACAAAGGAAAGAGAAGGGGAAGG + Intronic
1086683856 11:89707546-89707568 ACATAGGAAAGAGATGCGACTGG - Intergenic
1086854546 11:91850616-91850638 ACAAAGGAAGGAAAAGCCACAGG + Intergenic
1086903109 11:92389910-92389932 ACAAGGTAATGTGAAGACACTGG - Intronic
1086915403 11:92524308-92524330 ATAGAGGAATGAGAAGAGGTTGG - Intronic
1087492072 11:98840980-98841002 AAAAAGGAAAGAGAAGAGAGAGG - Intergenic
1087581842 11:100065723-100065745 ACTAAGGCATGAGATGAGAATGG + Intronic
1087788190 11:102379186-102379208 ACAAAGGCAAGAGAAGAGACTGG - Intergenic
1087912185 11:103767120-103767142 TCCAAGGAATGAAAAGATACAGG + Intergenic
1087938740 11:104067034-104067056 ACAAAGTGTTGAGATGAGACTGG - Intronic
1088214018 11:107487818-107487840 AAAAAGGAAAAAGAAGAAACTGG + Intergenic
1088705311 11:112457106-112457128 ACAAAAGAAATAAAAGAGACTGG - Intergenic
1089357952 11:117867663-117867685 TGAAAGTAATGAGAAGATACTGG - Intronic
1090267539 11:125362932-125362954 AAAAAGGAGTGGGAAGAGTCAGG - Intronic
1090508632 11:127347209-127347231 TCTAAGCAATGAAAAGAGACTGG + Intergenic
1091034181 11:132218261-132218283 CCAAAGGACTGAGAAGAAAAAGG + Intronic
1091067112 11:132524984-132525006 GCAAGGGAATGAGAGGAGTCTGG - Intronic
1091643831 12:2258033-2258055 CCAAAGGAAAGAGAAGAGGGAGG + Intronic
1091744011 12:2979566-2979588 ACAAATGACTGTGAAGATACTGG + Intronic
1091860450 12:3776789-3776811 GAAAAGGAAAGAGAAGAGAAAGG + Intergenic
1092094824 12:5832787-5832809 TCAAAGGATTGAGAGGAGTCAGG - Intronic
1092822633 12:12367237-12367259 ACAGAAGAATGTGAAGAAACTGG - Intronic
1092871567 12:12810341-12810363 ACAAAGGAATGAGAAGAGACAGG + Intronic
1093356415 12:18173387-18173409 ACCAAGGAAAGAGAAGCCACAGG + Intronic
1093507956 12:19891425-19891447 AAACATGAGTGAGAAGAGACAGG + Intergenic
1093680169 12:21993536-21993558 AGAAAAGAAAGAGAAGAGAAAGG + Intergenic
1093877120 12:24361929-24361951 ACACAGGGATGGGCAGAGACTGG + Intergenic
1094142450 12:27195113-27195135 GGAAATGAATGAGAGGAGACTGG + Intergenic
1094268929 12:28589819-28589841 ACCAAGGACTGAGAAGAGCAAGG + Intergenic
1095093598 12:38130734-38130756 AGAGAGGACTGTGAAGAGACTGG + Intergenic
1096040524 12:48511709-48511731 TCAAAGGAATGAGAAAAGGCAGG - Intronic
1096056848 12:48660158-48660180 AAAAAGGTATGGGAAGAGTCTGG + Intronic
1097141594 12:56907039-56907061 AAAAGGGAAGGACAAGAGACTGG + Intergenic
1097501605 12:60410432-60410454 ACAAAGAAATGAGCTGAAACTGG - Intergenic
1098020281 12:66148558-66148580 ACAAACAAATGAGAAGAGGAAGG - Intronic
1098122650 12:67257687-67257709 ACAAGGGAAAGAGAAAAGAAAGG - Intergenic
1098134896 12:67391791-67391813 AATGAGGCATGAGAAGAGACAGG + Intergenic
1098198218 12:68024919-68024941 ACAGAGGAATGAGAAGCCATTGG - Intergenic
1098280033 12:68853545-68853567 ACAAAGGAATGAAGAGCTACAGG - Exonic
1098362073 12:69664535-69664557 AAAAAGGAAGGAAAAAAGACAGG - Intronic
1098699261 12:73603755-73603777 ACAAAGGAAAGAGGAGAAAAAGG - Intergenic
1098914266 12:76240851-76240873 TCAAAGGAATGAGAAAAGACAGG - Intergenic
1100028653 12:90160304-90160326 ACAAAGGTATGAGCAGAAAATGG - Intergenic
1100035310 12:90243667-90243689 ACAAAGAAAAGAGAAGAGAAGGG - Intergenic
1100651184 12:96590697-96590719 AGAAAGGAGTGAAAAGTGACTGG + Intronic
1100663120 12:96722159-96722181 AGAAAGTAAGGAAAAGAGACTGG - Intronic
1100738561 12:97565524-97565546 ACAAATGAATGGGAAAAGAGGGG + Intergenic
1100893660 12:99155204-99155226 AAAAAGGAAGAAGAAAAGACAGG - Intronic
1101439118 12:104689878-104689900 AAAGAGGAAAGGGAAGAGACGGG - Intronic
1101815453 12:108142766-108142788 AGAAAGGAAGGAAAAGAGAGAGG - Intronic
1102531348 12:113548553-113548575 CCAAAGGGATGAGAAGCGAGTGG + Intergenic
1103037752 12:117670394-117670416 CCAAAGCAATGAGAAGATAAGGG + Intronic
1103686174 12:122733782-122733804 ACAAAGGATTTAGAAAAGAAAGG - Intergenic
1103887363 12:124212828-124212850 AGAAAGGAAGGAGAGGAGAGGGG - Intronic
1104475548 12:129067868-129067890 ACAGAGAGAGGAGAAGAGACAGG + Intergenic
1104577671 12:129982725-129982747 ACAAATGAATGGGGAGAAACAGG + Intergenic
1105039334 12:132949496-132949518 ACAAAGGAATGAGAAGAGACAGG - Intronic
1106193751 13:27476139-27476161 CCAGAGGAATGAGAGGACACTGG - Intergenic
1106233035 13:27836613-27836635 ACAAAGAAATGATTAGAGGCAGG - Intergenic
1107148997 13:37090704-37090726 ATGGAGGAATGAGAAGAGACAGG - Intergenic
1107188537 13:37551151-37551173 ACAATATAATGAGAAAAGACTGG - Intergenic
1107921583 13:45213653-45213675 AGAAAGGAAGGAAAGGAGACAGG - Intronic
1108591667 13:51917955-51917977 AGAAGGGAATGAGAGGACACTGG - Intergenic
1109889204 13:68585052-68585074 ACCAAGTAATGAAAAGAGAAAGG + Intergenic
1110421361 13:75313115-75313137 GCTAAGGAATGAGTAGAAACAGG - Intronic
1110633438 13:77736911-77736933 ACAAGGAAAAGAGAAGGGACTGG - Intronic
1110698978 13:78524998-78525020 TCAAAGGAATTTGAAGAGAGTGG - Intergenic
1111091850 13:83457061-83457083 ACAAAGGAAAGAACAGACACTGG - Intergenic
1111397266 13:87678790-87678812 GAAAAGGAATGAGAAGGGAGGGG - Exonic
1111414503 13:87921840-87921862 AAAATGGAATGAGAAGAGCATGG - Intergenic
1111745341 13:92260716-92260738 ATAAACAAGTGAGAAGAGACAGG - Intronic
1111802213 13:92995090-92995112 ACATAAGAATGAGAAGAGAGGGG - Intergenic
1112528793 13:100180622-100180644 AGAAAGAAATCAGAAGAGAGTGG - Intronic
1113128772 13:107010853-107010875 AGAAAGTAATTAGAAGAGCCGGG + Intergenic
1113456819 13:110455237-110455259 ACAAAGGGAGGGGAAGAAACCGG - Intronic
1114302787 14:21393412-21393434 AAAAGGGAAAGAGAAGAGAGGGG + Intronic
1114717910 14:24847125-24847147 ACAAAGAAAAGAGCACAGACTGG + Intronic
1114835940 14:26203175-26203197 AGAAAAGAAAGAGAAGAGAAGGG + Intergenic
1115678801 14:35712955-35712977 AGAAAGGAATAAAATGAGACTGG + Intronic
1115680852 14:35736550-35736572 ACAATGAAGTGAGAAGAAACAGG + Intronic
1116168613 14:41368320-41368342 ACAAAGGAAAGACAAAAGAAAGG - Intergenic
1116860375 14:49990718-49990740 ACCAAGGAAAAAGAGGAGACTGG - Intronic
1116915534 14:50521413-50521435 ATAATGGAAAGAGCAGAGACTGG + Intronic
1117288735 14:54312156-54312178 AGAAAGAAATGAGAAGAAATTGG - Intergenic
1117558191 14:56908129-56908151 ACAATGGAATATGAAGAGAATGG + Intergenic
1117660526 14:57999603-57999625 ACAGAGGAATTTGAAGAGGCAGG - Intergenic
1117790667 14:59337864-59337886 AGGAAGGATTGAGAAAAGACAGG - Intronic
1117797291 14:59407505-59407527 CCAAAGGACAGAGAATAGACAGG + Intergenic
1120036795 14:79706950-79706972 ACAAACGAATGAGAATAGACAGG - Intronic
1120525485 14:85572140-85572162 ACACAGAAATGAGAAAACACAGG - Intronic
1120587221 14:86328056-86328078 AACAAGGAATGAGAAGACAAGGG - Intergenic
1120597454 14:86458929-86458951 AGAGAGGAAGGAGAAGAGACAGG - Intergenic
1121638067 14:95467017-95467039 ACTAAGGCATGTGAAGAGGCAGG - Intronic
1121961858 14:98267497-98267519 ACAAATGAATGGGTAGAGACTGG + Intergenic
1122604138 14:102937332-102937354 ACAAAGGATGGAGAAGACAAAGG + Intronic
1123788059 15:23691923-23691945 AGAGAGGAGTGAGGAGAGACAGG + Intergenic
1124000578 15:25756200-25756222 ACAAAGGAAGGAGAGAACACTGG + Intronic
1124060362 15:26288335-26288357 ACAAAAGAAACAGAAGAGAGTGG - Intergenic
1124784164 15:32663760-32663782 ACAGAGGCATGAGAAGAAAATGG + Intronic
1125027966 15:35049900-35049922 AAAAAAGAATGTGGAGAGACAGG + Intergenic
1126380926 15:48046087-48046109 AGAAAGGAAGGAGAAAAGGCTGG + Intergenic
1126567065 15:50112160-50112182 GCAAAGGAATTAGAGGAGATTGG + Intronic
1126590262 15:50332181-50332203 ACAAAGGAGAGAAAAGAAACTGG - Intronic
1127121794 15:55778286-55778308 AGAAAGAAAAGAGAAGAGAGAGG - Intergenic
1127270837 15:57400287-57400309 ACCTAAGAATGAGAAGAGGCTGG - Intronic
1127395651 15:58542086-58542108 TCACAGGAATGAGAAGGCACAGG + Intronic
1127417783 15:58773810-58773832 CCAAAGGAATGAAAATAGAATGG + Intronic
1127558001 15:60107236-60107258 GCTAAGGAGTGAGAAGAGAGTGG + Intergenic
1127757206 15:62104374-62104396 ACAAATGATTTAGAAGAAACAGG + Intergenic
1128603084 15:69014480-69014502 GGAAAGGAAAGAGAAGATACTGG + Intronic
1128759969 15:70209914-70209936 ACAATGGAGTGAGGGGAGACAGG - Intergenic
1129531563 15:76269603-76269625 TCAAAGGAATGAGAAAAGACAGG - Intronic
1130510718 15:84587091-84587113 AAAAAGGACTGAGAAGAAAAGGG + Intergenic
1130815283 15:87425413-87425435 GCAAAAGAAAGAGAAGAGAGAGG - Intergenic
1130979245 15:88801876-88801898 ATAAAGAAATGAGATGAGGCCGG - Intergenic
1131096666 15:89659543-89659565 AGAAAGAAAAGAGAAGAGAAAGG + Intergenic
1131224328 15:90611442-90611464 AAAAAGGAATGAGTTGTGACTGG - Intronic
1132004436 15:98213729-98213751 ACAGAGGAAGAAGAAGAAACAGG + Intergenic
1132036620 15:98490710-98490732 CCTAAGGACTGAGAAGAGCCTGG + Intronic
1133068957 16:3232994-3233016 TCAAAGGAATGAGGACAGCCTGG - Intronic
1133191936 16:4140242-4140264 ACAGAAAAATGAGAAGAGCCTGG + Intergenic
1133743435 16:8669045-8669067 AAAAAGAAAAGAGAAGAGAAAGG + Intergenic
1133789180 16:8996077-8996099 ACGGAGAGATGAGAAGAGACAGG - Intergenic
1133817963 16:9212606-9212628 AGAAAGGAATGAGAGGAGAGGGG + Intergenic
1133890736 16:9876529-9876551 TCAAAGGAATGGGAAAAGACAGG - Intronic
1134001403 16:10785869-10785891 ACAAAGGAATGAGAAGAGACAGG - Intronic
1134001790 16:10788548-10788570 ACAAAGGAATGAGAAGAGACAGG + Intronic
1134351912 16:13445481-13445503 ACAAAGGAATGAGCATATATTGG + Intergenic
1134755307 16:16661961-16661983 GAAAAGGAAGGAGCAGAGACAGG + Intergenic
1134990758 16:18697209-18697231 GAAAAGGAAGGAGCAGAGACAGG - Intergenic
1135231963 16:20716797-20716819 TCAAAGGAATGAGAAAAGACAGG - Intronic
1135501230 16:22997702-22997724 AGAAAGGAATCAGAAGAAAGGGG - Intergenic
1135505851 16:23035442-23035464 AAAAGAAAATGAGAAGAGACAGG - Intergenic
1135624525 16:23982410-23982432 AAAAAGAAAAGAGAAGAGAAGGG - Intronic
1135741186 16:24976537-24976559 AGAAAAGAAAGAGAAGAGAAGGG + Intronic
1135964198 16:27022388-27022410 ATAAATGAATGAAAAGGGACAGG + Intergenic
1136519818 16:30787972-30787994 ACCAAGGTGTGAGAAGCGACTGG + Intergenic
1138502702 16:57457908-57457930 ACAAAGGAAGAAGCAGAGATAGG - Intronic
1138527440 16:57617193-57617215 ATAAAGGGAAGAAAAGAGACAGG - Intronic
1139148436 16:64350890-64350912 ACCAGGGAATGGGCAGAGACTGG + Intergenic
1139150249 16:64373466-64373488 ACAAAGCAAGGAGAAAAGTCAGG + Intergenic
1139856305 16:69983097-69983119 ACAAAAGAATGACATGAGGCTGG + Intergenic
1140183242 16:72741830-72741852 AGAAAGGAATGACTGGAGACTGG - Intergenic
1140302866 16:73775039-73775061 AAAATGGAATGAGAAGAGGCGGG - Intergenic
1140435654 16:74944809-74944831 AAAAAGCAATGAGAACAGGCAGG + Intronic
1140721287 16:77774681-77774703 GAAAAGGAATGAAAAGAAACAGG - Intergenic
1140990645 16:80208065-80208087 ACACAAGAATAAAAAGAGACTGG + Intergenic
1141181898 16:81759246-81759268 ACAAAACAATGAGAAGGAACTGG - Intronic
1141266002 16:82497967-82497989 ACAAAGGAAAGAAAAGGCACAGG - Intergenic
1141537032 16:84689090-84689112 ACTAAGGAATGAGGAGGGACAGG - Intergenic
1142494543 17:299377-299399 ACAAAGGTAAGAGGAGAGTCTGG + Intronic
1142708143 17:1709411-1709433 AAAAAAGAATGAGGAGAGACTGG + Intronic
1143204898 17:5134603-5134625 ACACGGGAATGGGGAGAGACAGG + Intronic
1143621434 17:8082774-8082796 ACGAAGGAATGAGAAGAGACAGG - Intronic
1144409276 17:14984798-14984820 GCAGAGGAATGAGGAGACACGGG + Intergenic
1145072142 17:19819795-19819817 AGTAAGGAAGGAGAAGAGCCAGG - Intronic
1145159216 17:20563176-20563198 TCATAGGAATGAGAAAAGACAGG + Intergenic
1146443022 17:32913660-32913682 ACGAAGGAATGAGAAGATACAGG - Intergenic
1146516573 17:33494251-33494273 AGAAAAGCATGAGAAAAGACAGG - Intronic
1146560051 17:33860253-33860275 AGAAAGGAAGGGGAAGAGAAGGG + Intronic
1146806079 17:35866056-35866078 AGAAAGGCTTAAGAAGAGACAGG - Intronic
1146899492 17:36573393-36573415 ACAAAGAAATGTGAATAGCCAGG - Intronic
1146911822 17:36653323-36653345 ACAAAGGCATGCAAAGAGACTGG - Intergenic
1147550262 17:41436911-41436933 AGAAGGGAATTAGAAAAGACAGG + Exonic
1147957591 17:44145043-44145065 ACTAAGGAATGAGAAGAAATGGG - Intronic
1148643477 17:49205500-49205522 ACAAAGGCATGATATGAGAAAGG - Intronic
1149203671 17:54217839-54217861 ACAAAGGCAGGAGCAGAGAACGG - Intergenic
1149879317 17:60272351-60272373 TCTGAGGAATGAGGAGAGACAGG - Intronic
1150177615 17:63077398-63077420 AGAAATGAATTACAAGAGACAGG + Intronic
1150969875 17:70015790-70015812 ACCCAGGGATGAGAAGAGATTGG - Intergenic
1151163913 17:72188144-72188166 ACAAAGAGAGGAGAAGAGAGAGG + Intergenic
1151521337 17:74632498-74632520 ACAGAGAAATGATATGAGACAGG - Intergenic
1153483150 18:5567590-5567612 AGAAAGAAAGGAGAAGAGATAGG + Intronic
1153781544 18:8499375-8499397 ACAGAGGAACCAGAAGAGAGAGG - Intergenic
1153785867 18:8534903-8534925 AAAAAGGAATGAGATCAGCCGGG + Intergenic
1153860888 18:9204454-9204476 TCTACAGAATGAGAAGAGACAGG - Exonic
1154489006 18:14904622-14904644 ACAGAGGAATCAGATGAGATGGG - Intergenic
1155821004 18:30376802-30376824 GGAAAGAAATGAGAGGAGACTGG - Intergenic
1156493776 18:37512406-37512428 AGAAAGGAAAGAGAAAAGAAGGG - Intronic
1156804399 18:41160219-41160241 ATAAATGAAGGAGAATAGACAGG - Intergenic
1157191243 18:45583573-45583595 ATAAATGAATGAGATAAGACAGG + Intronic
1157404389 18:47410838-47410860 AGAGAGGAAAGGGAAGAGACAGG - Intergenic
1158239396 18:55360103-55360125 ACAAAGAAATGGCAAGAGAAGGG + Intronic
1158286005 18:55883802-55883824 ACAAAGCAATGTGTAGAGAGTGG - Intergenic
1158886944 18:61837523-61837545 ACACAGAAATGTGGAGAGACTGG - Intronic
1159641872 18:70872845-70872867 ACAAATGGAGGAGAAAAGACAGG - Intergenic
1159769404 18:72530999-72531021 ACAAAAGAATGACAAGGGGCTGG - Intergenic
1160366752 18:78332821-78332843 GCAAAGGAATGGGATGACACAGG - Intergenic
1161178550 19:2863791-2863813 ACGAAGGAATGAGAAGAGACAGG - Intergenic
1161865083 19:6827568-6827590 AAAAAGCAATGGGAAGAGGCTGG - Intronic
1162151260 19:8647274-8647296 ACAAAGGAATGAGATCGGCCAGG + Intergenic
1162963866 19:14146354-14146376 AGAAAAGAAAGAGAAGAGAAAGG - Intergenic
1163351726 19:16780634-16780656 GAAAAGGAAAGAGAAGAGAAAGG - Intronic
1163625227 19:18385761-18385783 ACAAAGGAAGCAGAGGAGAACGG - Intronic
1163864550 19:19761828-19761850 AAAAAAGAATTAGAATAGACAGG + Intergenic
1163919216 19:20273195-20273217 TCAAAGGAATGAGAAAAGACAGG + Intergenic
1164093937 19:21987946-21987968 ACGAAGGAATGAGAAGAGACAGG - Intronic
1164520750 19:28977243-28977265 ACAAGGGGAGGGGAAGAGACAGG + Intergenic
1164581455 19:29437968-29437990 TAATTGGAATGAGAAGAGACAGG + Intergenic
1164756988 19:30696988-30697010 ACAAAGATATGATCAGAGACAGG + Intronic
1164869554 19:31631719-31631741 ACCAAGGGAGGAGAAGAGAAAGG + Intergenic
1165556441 19:36636595-36636617 ACAAAGGAATGAGAAGAGACAGG + Intergenic
1165848146 19:38832309-38832331 GTAAAGGAATGAGTACAGACGGG + Intronic
1166159040 19:40937994-40938016 GCAGAGGAATGAGAGAAGACAGG + Intergenic
1166167990 19:41005926-41005948 GCAGAGGAATGAGAGAAGACAGG + Intronic
1166424739 19:42667608-42667630 ACAAAGGAATGAGCAGAGACAGG + Intronic
1166619475 19:44283269-44283291 ACAAAGGAATGAGAAGAGACAGG + Intronic
1166794228 19:45416722-45416744 ACACAGGAAGGAGAAGGGAAGGG + Intronic
1166897201 19:46031393-46031415 ACGAAGGAATGAGAAGAGACAGG - Intergenic
1167703768 19:51066202-51066224 AAAAAGGGTTGAGATGAGACTGG - Intergenic
1168056406 19:53867453-53867475 AGAAAGGAGTGAGGTGAGACGGG + Intronic
1168244133 19:55101983-55102005 ACATAGAGATGAGCAGAGACAGG + Intronic
925974790 2:9134493-9134515 ACAGAGGATTGAGAAGCGAGAGG + Intergenic
928276772 2:29908343-29908365 AGAGAGGAAAGAGAAGAGAAAGG - Intronic
928355419 2:30608944-30608966 TCACAGGAATGAGAGGAAACAGG - Intronic
928604149 2:32928454-32928476 ACAAATGAGGGAGAAGAGAAGGG + Intergenic
928619404 2:33073228-33073250 ACAAAAGAATGAGGAAAGGCTGG - Intronic
928766228 2:34649487-34649509 ACAAAGGTAACAGAAGATACAGG - Intergenic
928906259 2:36371191-36371213 ACAAAGGAAAGAGCATAAACTGG - Intronic
928912386 2:36435195-36435217 ACAAAGTCAAGAGAAGAGTCTGG - Intronic
929137449 2:38638050-38638072 GAAAAGGAAAGAGAAGAGACAGG + Intergenic
929496237 2:42446585-42446607 ACAATGGAGAGAGAAGAAACTGG + Intronic
930005027 2:46889794-46889816 AAAAAGAAATGACAAGAGATTGG + Intergenic
930020394 2:46998357-46998379 ACAAAGGCAGGAGAAAAGGCAGG - Intronic
932995169 2:76843187-76843209 ACAAAGGCCAGAGAAGAGAGAGG + Intronic
933120894 2:78536799-78536821 AGAAAGAAAAGAGAAGAGAAAGG + Intergenic
933307199 2:80616480-80616502 ACAAAAGATTGAGAAAAGTCAGG - Intronic
933637339 2:84722239-84722261 ATAAAGGAATGAAAGGAGAAGGG - Intronic
933640000 2:84748679-84748701 ACTGAGTAATGAGAAGATACTGG - Intronic
933835954 2:86245681-86245703 ACAAAGGAATGAGAAGAGACAGG - Intronic
934126896 2:88903455-88903477 AATATGGAATGAGAGGAGACAGG + Intergenic
934884330 2:98011305-98011327 GAAAAGGAATGAAGAGAGACAGG - Intergenic
936364642 2:111841757-111841779 CCACTGGACTGAGAAGAGACTGG + Intronic
936796878 2:116216669-116216691 GAAAAGGAAGGAGAAAAGACCGG - Intergenic
936844856 2:116818578-116818600 CAAATGCAATGAGAAGAGACAGG + Intergenic
937406078 2:121630565-121630587 AACAAGAAATGAGAAGAGGCCGG + Intronic
938085118 2:128394826-128394848 ACAAAGGAGTGAGATAACACTGG + Intergenic
938393648 2:130924770-130924792 CAAGAGGAATGAGAGGAGACTGG + Intronic
938860066 2:135358962-135358984 AAAAAACAAGGAGAAGAGACAGG - Intronic
939138885 2:138329621-138329643 AAAAAAGAATGAGAGTAGACAGG + Intergenic
939289868 2:140180271-140180293 ACAAAGGAGTGGGATGTGACTGG - Intergenic
939835491 2:147125129-147125151 ACAAAGAAATGACCAGAAACTGG + Intergenic
940213328 2:151278333-151278355 GCCAACGAATGAGAAGAGCCTGG - Intronic
940929417 2:159409026-159409048 ACAAATAAATGAGAAGATACTGG - Intronic
941963473 2:171276613-171276635 ACAAAAAACTGAGAAGAGGCTGG - Intergenic
942383863 2:175421137-175421159 AAAAAGGAAGGAGCAGAGGCTGG - Intergenic
942588518 2:177513856-177513878 ACAAGGGAATGCAAAGAGAAGGG + Exonic
942953906 2:181751748-181751770 AGAAGGGAATGGGAAGAGAAGGG + Intergenic
943086464 2:183317795-183317817 ACAGGTGAATGAGAAGAGAAAGG - Intergenic
943689576 2:190855702-190855724 ACCATGGCATGAGAGGAGACAGG - Intergenic
944222027 2:197311850-197311872 ACAAAGGAATCAGACCAGACTGG + Intergenic
944312915 2:198254715-198254737 AGAAGGGAATGAGTGGAGACAGG + Intronic
944837742 2:203596905-203596927 ACACAGGGATGAGAAGGAACAGG - Intergenic
945470812 2:210225775-210225797 ACACAGGATTTAGTAGAGACAGG + Intergenic
945571820 2:211477507-211477529 ACAAAGGAAAGAGAATGGAAAGG + Intronic
945607137 2:211948788-211948810 CCAAGGGAGTGAGAATAGACAGG - Intronic
945987554 2:216367451-216367473 AAAAAAAAATGAGAAGAAACTGG + Intronic
946034283 2:216729498-216729520 ACAAAGGAATGGGAAGTGAAAGG + Intergenic
946071021 2:217034524-217034546 AAAGAGGACTGAGAAGCGACTGG - Intergenic
946324317 2:218976534-218976556 GCAGAGGAATAAGAAGATACAGG + Intergenic
946647703 2:221855905-221855927 AAAAAGGAATGAAAAGACAATGG - Intergenic
946970037 2:225081390-225081412 AAAATGGAATGAGAATGGACAGG + Intergenic
947567617 2:231204658-231204680 ACAAAGGGCTGAGAAGTGATGGG + Intronic
947648685 2:231765655-231765677 CCAAAGTAATGAGAAGGGAGAGG - Intronic
948407713 2:237735071-237735093 ACAAGGAAATGAGGAGAGACCGG - Intronic
948520010 2:238530252-238530274 ACATAGGAATCAGCAGAGGCTGG + Intergenic
948537894 2:238659704-238659726 ATGAAGGAATGAGAAGAGACAGG - Intergenic
948822370 2:240556673-240556695 ACAAAGGATTGAGAAGAGACAGG - Intronic
1169039554 20:2481758-2481780 ACAAAGGGATAAGAAAACACGGG + Intronic
1169066034 20:2694428-2694450 GCAAAGGAGTCAGAGGAGACCGG - Intronic
1169250023 20:4053009-4053031 ACAAAGTTATGGGAAGGGACAGG - Intergenic
1169525327 20:6418155-6418177 ACAAAGGAAGGAAAAGAGAGAGG + Intergenic
1169822986 20:9734383-9734405 AAAAGGGAATGATAAGAGAAGGG + Intronic
1170461371 20:16579692-16579714 ACAAAGCATTTGGAAGAGACAGG - Intergenic
1171025189 20:21623798-21623820 AAAAAGGAAGGAGAAGGGAAGGG - Intergenic
1171102165 20:22394399-22394421 ACCCAGGGATGAAAAGAGACAGG - Intergenic
1171203985 20:23265111-23265133 TCAAAGTACTGAGAAGAAACGGG + Intergenic
1172390213 20:34560599-34560621 AGACAGGAAGGAGAAGAGGCAGG - Exonic
1172949295 20:38712328-38712350 GCACAGAAATGAGAAGAGAGGGG + Intergenic
1173078798 20:39846322-39846344 ACAAAGGAAAAGGTAGAGACGGG + Intergenic
1173331449 20:42079167-42079189 ACTAAGAAATTAGATGAGACTGG + Exonic
1174058676 20:47817125-47817147 AGAAAGGTATGAGCAGTGACGGG - Intergenic
1174733216 20:52938436-52938458 TGAAAGGAATGAAGAGAGACTGG + Intergenic
1174755338 20:53152969-53152991 ACAGAGGAATGAGTAGAGGGTGG + Intronic
1174763521 20:53229877-53229899 AGAAAGGAAGGAAAAGAGAGAGG + Intronic
1174768078 20:53272458-53272480 AGGAAGGAAGGAGAAGAGAGAGG + Intronic
1175104054 20:56601490-56601512 ACAAAAAAAAGAGAAAAGACCGG + Intergenic
1175736239 20:61389565-61389587 ACAAAGGATAGAGAAAAGACTGG + Intronic
1176959054 21:15139233-15139255 GCAAAGGAAAGAAAAGAGAAGGG + Intergenic
1178149880 21:29782010-29782032 ACTAAGGAATGAGTAGAGGATGG - Intronic
1178296623 21:31415690-31415712 ACAAAGCAATGTGAAGAAAAGGG - Intronic
1179258438 21:39737801-39737823 CCAAAAGAATGTGAACAGACAGG - Intergenic
1179282273 21:39944129-39944151 TCAAAGGAAGGAAGAGAGACTGG + Intergenic
1179522012 21:41951928-41951950 ACAAAGGACACAGATGAGACTGG + Intronic
1179780700 21:43698999-43699021 ACAAAGGAATGAGAAGAGACAGG - Intergenic
1179787711 21:43739343-43739365 ACAAAGGAATGAGAAGAGACAGG - Intronic
1180246990 21:46554959-46554981 ACAAAGAAAGGAAAAGGGACTGG - Intronic
1181142735 22:20818980-20819002 ACAAAGGAATGAGAAGAAACAGG + Intronic
1181363396 22:22355761-22355783 AAAAAGCAATGAGAAGAAACAGG + Intergenic
1181366279 22:22379206-22379228 AAAAAGCAATGAGAAAAAACAGG + Intergenic
1181962441 22:26632433-26632455 AAAAAGGTATGAGAAGTGTCAGG - Intergenic
1182668004 22:31973067-31973089 AGAAAGAAATGAGAAAAGGCAGG + Intergenic
1183077624 22:35436794-35436816 ACAAACAAATGAGAAGGGGCTGG + Intergenic
1183834910 22:40444251-40444273 ACAACAGAAAGAAAAGAGACTGG + Intronic
1184324488 22:43772662-43772684 AGAAAGAAATGAAAAGAAACTGG + Intronic
1184548327 22:45189211-45189233 ACAAAGGATTGAGAAGAGACAGG - Intergenic
1184724274 22:46334486-46334508 ATAAAGGAAGGAGGAGAGAATGG - Intronic
1185093338 22:48789488-48789510 AAAAAGGAAAGAAAAGAAACTGG + Intronic
949132111 3:515986-516008 AGAAGGGAAGGAGAAGAGAGAGG + Intergenic
949366244 3:3284634-3284656 ACAAAGCAATAAGCAGAAACAGG - Intergenic
949470461 3:4390586-4390608 AAAAAGGAAATAAAAGAGACAGG + Intronic
949611544 3:5708232-5708254 ACCAAGGAAGGAGAAGCCACAGG - Intergenic
950729143 3:14941575-14941597 ACAAAAGAACTAGAAGAGGCTGG + Intergenic
951574686 3:24101571-24101593 ATAAATGAATGAGAAGAGAAGGG + Intergenic
951956056 3:28255208-28255230 ACAAAGCACTGAGAAGGAACTGG - Intronic
952027944 3:29106228-29106250 AAAAAGGAAGGAGAGGAGGCAGG + Intergenic
952973562 3:38673321-38673343 ACCAAGGAAAAAGAAGAGATTGG + Intergenic
953242987 3:41166145-41166167 GCAAAGACATGAGAAGAGAAGGG - Intergenic
953920704 3:46949416-46949438 ATGAAGGAAGGGGAAGAGACTGG - Intronic
955213778 3:56966520-56966542 AGAAAGGCATGAGATGAGGCTGG + Intronic
955419786 3:58724761-58724783 ACAAAGGATTGAGAAGAGACAGG - Intronic
955483537 3:59413539-59413561 AGGAAGGAAGGAAAAGAGACAGG - Intergenic
955498436 3:59560878-59560900 AGAGAGGAAAGAGAAGAGACTGG - Intergenic
955573045 3:60328204-60328226 AGGCAGGAATGAGCAGAGACAGG + Intronic
955597286 3:60605565-60605587 ACAAATGAATGAAAAGACATAGG - Intronic
955925903 3:64004861-64004883 AGAAAGGAGTGAGAAGGGAGAGG - Intergenic
956369336 3:68541176-68541198 GAAAAGGAAAGAGAAGACACTGG + Intronic
957191105 3:77010889-77010911 AGAAAGGAAGGAGAAGAAAGAGG - Intronic
957633638 3:82752304-82752326 AGAAAGGAAAGAGGAAAGACAGG - Intergenic
957875335 3:86138914-86138936 ACTAAGGAATGAGAAGGGCTTGG - Intergenic
958491584 3:94781551-94781573 ACAAAGGAATCAGAAAAAAGTGG - Intergenic
959012104 3:101089584-101089606 ACAAAGGATTGAGAAGAGACAGG - Intergenic
959738891 3:109693240-109693262 TCAAAGGAATGAGAAAAAACAGG - Intergenic
960324652 3:116280991-116281013 GAAAAAGAATGGGAAGAGACAGG + Intronic
960455847 3:117870445-117870467 ACAAAGGAAAGAGAAGAAGGAGG - Intergenic
960720835 3:120623047-120623069 ACCAAGGAAGGAGAAGCCACAGG - Intergenic
961547454 3:127645134-127645156 AGCAAGGAAGGAGAAGAGGCTGG - Intronic
961712018 3:128835099-128835121 ACAAAGGATTGAGAAGAGACAGG - Intergenic
961721374 3:128898873-128898895 ACAAAGAAATGAAAAAAGGCGGG - Intronic
961931291 3:130536291-130536313 ATGAAAGAATGAAAAGAGACAGG - Intergenic
962095408 3:132287689-132287711 AAAAGGGAATGAGAACAGCCAGG - Intergenic
962357442 3:134706863-134706885 GGAAAGCAATGTGAAGAGACAGG - Intronic
962557159 3:136565139-136565161 AGAAAGGAAAGAGAAGGGAAAGG + Intronic
963296010 3:143547561-143547583 GCAGAGCAGTGAGAAGAGACAGG - Intronic
964309043 3:155372810-155372832 ATGAATGAATGAGATGAGACAGG - Intergenic
964399612 3:156285404-156285426 ACATAGCACTGAGAGGAGACAGG - Intronic
964472767 3:157071899-157071921 AGAAAGAAGAGAGAAGAGACAGG + Intergenic
965732242 3:171784520-171784542 GCAGGGGAATGATAAGAGACTGG - Intronic
965807607 3:172558371-172558393 ACAAAGGAATACTGAGAGACGGG - Intergenic
965915212 3:173837156-173837178 ACATAAAAATGAGAAGAAACAGG + Intronic
966115384 3:176454436-176454458 ATATAGGAAAGAGAAGAGTCTGG - Intergenic
966374102 3:179277963-179277985 CCAAAGGAATCAGAAGAAAAGGG - Intergenic
967356896 3:188581862-188581884 ATAAAGGAAATATAAGAGACTGG - Intronic
967520916 3:190432255-190432277 GTAAAGGAAAGAGAAGAAACAGG - Intronic
967619328 3:191613640-191613662 ACAAAGTAATGGGAAGAGATGGG - Intergenic
969647653 4:8441781-8441803 ACGAAGGAATGAGACGAGACAGG + Intronic
970290769 4:14569670-14569692 ACAAAGAAGGGAGAAGACACTGG - Intergenic
970728235 4:19072485-19072507 ACAAACGAAAGAGAAGTGACAGG + Intergenic
971304496 4:25467821-25467843 ACATAGGAAAGGGAAGAGAAAGG + Intergenic
971767325 4:30850000-30850022 CCAAAGGAAACAGAACAGACTGG - Intronic
971909101 4:32771572-32771594 CCAAAGGAATGTGAGGAGAGTGG - Intergenic
971986748 4:33835907-33835929 AAAAAAGAATGAGAAAAGAGAGG - Intergenic
973061621 4:45733509-45733531 AGAATGGAATGAGAAGAGTGTGG - Intergenic
973329736 4:48900942-48900964 CCAAAGGAATGGTAAGAGATGGG - Intronic
974114040 4:57558815-57558837 AAAAAGGAATGGGAAAACACCGG - Intergenic
974224533 4:59021465-59021487 ACAAAGCCATGAGAAGATAGAGG - Intergenic
975080973 4:70280410-70280432 ACAAGGCAATGAGCAGAGTCAGG + Intergenic
975630986 4:76402167-76402189 AAAAAAGAATGAGGAGAGAGGGG + Intronic
975924461 4:79432278-79432300 AACTAGGAATGAGAAGATACAGG + Intergenic
976904805 4:90224293-90224315 ACAAAGCAATGATAATAGAAAGG - Intronic
977300658 4:95263393-95263415 ACAAAGGCATGAGAGGATAGTGG + Intronic
978203679 4:106053225-106053247 GCAAAGAAATGAAAAGAGATAGG - Intronic
978428019 4:108602713-108602735 ACAACGGAATGAGAAAAAATAGG - Intergenic
978889351 4:113804706-113804728 ACAAATGAATAAGAAAAGACAGG + Intergenic
979001862 4:115231340-115231362 AAAGAGCAATGTGAAGAGACTGG + Intergenic
979191093 4:117859703-117859725 ACAAAGGAAACAGCAGACACTGG + Intergenic
979654318 4:123174592-123174614 ACTAACGAAACAGAAGAGACAGG + Intronic
979720942 4:123899777-123899799 ACAAAGGGAAGAGGGGAGACTGG + Intergenic
979876556 4:125898811-125898833 AGGAAGGAAGGAGAAGAGAAGGG - Intergenic
980843835 4:138300296-138300318 GCAAAGGAATAAGAAGGGACAGG - Intergenic
981125322 4:141099416-141099438 GAAAAAGAAAGAGAAGAGACAGG + Intronic
981934192 4:150221296-150221318 ACAAAGAAAGGAGAAGAGGATGG - Intronic
981987236 4:150872935-150872957 ACTAAGAAATGAGAAGAAATTGG + Intronic
982106572 4:152016564-152016586 ACAAATGAGAGAGGAGAGACAGG + Intergenic
982383797 4:154778573-154778595 ACAAAGGAAAGAGAAGCAATGGG - Intergenic
982757662 4:159242146-159242168 ACAAAGGAATAAGAAAAAAAAGG - Intronic
982864998 4:160499479-160499501 CCAAAGGAATAAGAAGAAACTGG + Intergenic
983552535 4:169032301-169032323 AGAAAGGAAAGAGGAGAGAGAGG - Intergenic
984527973 4:180880159-180880181 ACAGAGGAATGAGAACTGAATGG + Intergenic
984915349 4:184718494-184718516 ACGTAGGAGTGAGATGAGACTGG + Intronic
985076093 4:186216432-186216454 ACAAAGAATGGTGAAGAGACAGG + Intronic
986204641 5:5612036-5612058 ACCAAGGAGAGAGAAGAGACAGG + Intergenic
986599329 5:9455972-9455994 ACAAAGCACTGAGAGGAGAAAGG + Intronic
986716564 5:10528599-10528621 ACGATGGCATGAGAAGAGGCAGG - Intergenic
987729112 5:21744745-21744767 AAAAAGAAATGAGAACAGAAGGG + Intergenic
987742019 5:21921648-21921670 AAAAAGGCATGAGAACAGAAAGG - Intronic
987826682 5:23038887-23038909 ACAAAGAAATGAGAGCAGAGGGG + Intergenic
988404819 5:30810706-30810728 AGAAAGGAATGAGAAGAAGAGGG + Intergenic
989279322 5:39622487-39622509 ACAGAGGAATGGGCAGAGAGGGG - Intergenic
990559253 5:56967121-56967143 ATAAAGAAAAGAAAAGAGACCGG + Intronic
990580462 5:57162911-57162933 ATAAATGAATGAGCAGAGAGTGG - Intergenic
990647483 5:57860716-57860738 ACAAAGGAATAATAAGACAGAGG + Intergenic
991141420 5:63248489-63248511 ACAAAGGACTGAGTAGATATTGG + Intergenic
991687191 5:69192250-69192272 ACAAAGGCATGATAAGAGGGAGG + Intronic
992196119 5:74340668-74340690 ACAAAAGAAAGAAAAGAGAAAGG - Intergenic
992504153 5:77368904-77368926 ACAAAAGAAAAAGAAGAGGCTGG + Intronic
993159863 5:84276152-84276174 ACAAAAGAATGAGATAAGATAGG - Intronic
993884268 5:93397876-93397898 TCTAAGGAATCAGAAGAGACAGG + Intergenic
994084735 5:95745280-95745302 ACAAAGGAAAGAAATGAGACTGG - Intronic
994104437 5:95930691-95930713 AGGAAGGAATGATGAGAGACTGG + Intronic
994285096 5:97955429-97955451 ACAAAGAAATGACATGAAACTGG + Intergenic
995363838 5:111331580-111331602 ACAAAGGCAAAAGAATAGACTGG - Intronic
995376469 5:111479912-111479934 AGAAAGGCATGAGAAGAGGCAGG - Intronic
995412756 5:111877288-111877310 ACAAAGGATTGAAAAGTGACAGG - Intronic
996118302 5:119643328-119643350 CCCCAGGAATGAGAAGAGAAGGG - Intergenic
996437059 5:123446090-123446112 ACAAAGTCATGAAAAGAGATGGG + Intergenic
996438487 5:123461951-123461973 AGAAAGGAAAGAGAAGAAAAAGG - Intergenic
996899269 5:128525006-128525028 ACACAGGAATGAGAAGGCAGGGG - Intronic
997744059 5:136283360-136283382 AGATGGGCATGAGAAGAGACAGG - Intronic
998263211 5:140647192-140647214 ACAAGGGTTTGAGAAGAGAAGGG - Intronic
998433712 5:142088812-142088834 ACAAAGGAATGAGAAGAGACAGG + Intergenic
999126245 5:149248198-149248220 ACAAAAGAATCAGAAGAGGCTGG + Intronic
999522356 5:152363910-152363932 AAAAAGGAATGAGATCAGCCAGG + Intergenic
999525309 5:152399031-152399053 TCAAAGGAAGGAGAAGACAGTGG - Intronic
1000847753 5:166302750-166302772 GCAATGCAATGAAAAGAGACTGG - Intergenic
1000901589 5:166917992-166918014 ACAAGGGAATGAATAGAGAGGGG + Intergenic
1001208638 5:169789154-169789176 CCAAAGGTATGAGTGGAGACAGG - Intronic
1001798517 5:174523010-174523032 AAACAGGAAGGAGAAGAAACAGG - Intergenic
1002369748 5:178742203-178742225 TCAAAGGAATGAGAAAAGAGAGG + Intergenic
1002453213 5:179331342-179331364 AAAGAGGAATGAGAAAAGAAGGG + Intronic
1003057522 6:2835737-2835759 ACAAAGGAATGACAAACTACTGG + Intronic
1003179658 6:3780805-3780827 CCACAGGAATGAGCAGAGACTGG + Intergenic
1003517252 6:6827405-6827427 ACAGAGGAGAGAGAAGAGAAAGG + Intergenic
1003685093 6:8294884-8294906 ACAAAGTCATGAGTAGTGACAGG - Intergenic
1003906171 6:10701595-10701617 ACAAATGAATGAGAAGTGTGTGG + Intronic
1003945270 6:11069817-11069839 GCAGATGAATCAGAAGAGACTGG - Intergenic
1004163907 6:13238920-13238942 AAAAAGGAAGGAAAATAGACTGG + Intronic
1004277432 6:14250829-14250851 ACCAAGGAAAGAGAAGACTCTGG - Intergenic
1004582701 6:16969925-16969947 AGAAAGGAAAGAAAAGAGAGAGG + Intergenic
1004639769 6:17503877-17503899 AGAAGGGAAAGAGAGGAGACAGG + Intronic
1005550819 6:26912870-26912892 ACAAATGAATGAGATAAGAGAGG + Intergenic
1005575771 6:27187996-27188018 ACAAAGGAATGAGAAGAGACAGG - Intergenic
1005576667 6:27196204-27196226 ACGAAGGAATGAGAAGAGACAGG - Intergenic
1005734799 6:28735346-28735368 ACAAAGAAAAAAGAAAAGACTGG + Intergenic
1006150563 6:31984744-31984766 ACACAGGAATGAGAAGAGACAGG + Intronic
1006151119 6:31990557-31990579 ACAAAGGAATGAGAAGAGACAGG + Intronic
1006156864 6:32017482-32017504 ACACAGGAATGAGAAGAGACAGG + Intronic
1006157420 6:32023295-32023317 ACAAAGGAATGAGAAGAGACAGG + Intronic
1006223238 6:32513311-32513333 ACAGAAGAATGAGAAGAGACAGG - Intergenic
1006294331 6:33163374-33163396 ACAAATGGAAGAGAAGAGAAAGG - Exonic
1006827158 6:36944009-36944031 AGAAAAGAAAGAGAAGAGCCAGG + Intergenic
1007649722 6:43411722-43411744 AAAAAGGAATGTGAAAAGACTGG + Intergenic
1007995991 6:46308533-46308555 ACTAATGAATGAGATGAGAAAGG + Intronic
1008405434 6:51113804-51113826 AAGAATGAATCAGAAGAGACAGG - Intergenic
1008735058 6:54533225-54533247 ACAAAGGAATAAAAAAACACAGG - Intergenic
1009187737 6:60594059-60594081 AGAAATGAATGAGCAGAGAAGGG + Intergenic
1009661585 6:66619555-66619577 ACAAAGGTATGACCCGAGACTGG + Intergenic
1009864763 6:69383433-69383455 GTAAATGAATGAGAAGAGAATGG - Intronic
1009936944 6:70245612-70245634 ATAAAGGAATAAGAAGAAACTGG + Intronic
1010012283 6:71062188-71062210 AGAACGGAATGAGAAGAGGTTGG - Intergenic
1011025387 6:82863222-82863244 AAAAAGGAAAGAGAAAAGATGGG - Intergenic
1011528763 6:88296904-88296926 ACAAAGAGAGGAGAAGAGAGAGG - Intergenic
1012393106 6:98766008-98766030 ACAGATGAAAGAGAAGATACAGG + Intergenic
1012869554 6:104657481-104657503 AAAAAAGAATGAAAAGAGGCCGG + Intergenic
1013310919 6:108892894-108892916 ACACAGGAAGGAGAAGCCACGGG + Intronic
1013469445 6:110448913-110448935 ACAAAGGAAAAAGAAGTGAAGGG - Intronic
1013713786 6:112933460-112933482 ACAAAGGTATCAGAAGATATAGG + Intergenic
1013808456 6:114018291-114018313 ACAAAGGAATGAGAAGAGACAGG - Intergenic
1014108425 6:117592873-117592895 ACTAAGGAAGGAGAATTGACAGG - Intronic
1014408515 6:121083906-121083928 AGAAAGGTAAGAGATGAGACAGG - Intronic
1014526215 6:122504897-122504919 ACAAAGGAATGAGAAGAGACAGG + Intronic
1014526902 6:122511589-122511611 ACAAAGGAATGAGAAGAGACGGG + Intronic
1014743545 6:125173110-125173132 ACCAGGGAGTGAGAAGAGACAGG - Intronic
1015539723 6:134301586-134301608 AAAAAGAAAAGAGAAGAGAAGGG - Intronic
1015752655 6:136575934-136575956 GCAAAAGAATGAGGAGAAACAGG - Intronic
1015815394 6:137205611-137205633 ACAAATGAATGACAAAAGATGGG + Intronic
1015937285 6:138416343-138416365 AGAAAGGAATGAGAAGGCTCAGG + Exonic
1016680639 6:146825115-146825137 ATACAGGAATGAGAAAAGGCAGG + Intergenic
1016885767 6:148958211-148958233 AAAAAGGAAAAAGAAGAAACAGG - Intronic
1017157824 6:151338391-151338413 AATAAGGAATGAGTAGAAACGGG - Intronic
1017208576 6:151830284-151830306 ACAAATGGAGGAGAAGAGAAGGG - Intronic
1017357676 6:153528776-153528798 ACAAAGGAAGGAGCAGGGAGGGG + Intergenic
1017692807 6:156983926-156983948 ACACAGGAATGAGAAAAGCAAGG - Intronic
1017849886 6:158296190-158296212 AAAAAGGAATGGGAAGGGAAAGG - Intronic
1018583226 6:165326140-165326162 AGAATGGAAGGAGAAGAGATTGG - Intergenic
1019106600 6:169672800-169672822 GCAAAGGAGTGAGAGGAGGCTGG + Intronic
1019463460 7:1173566-1173588 ACAAAAAAAAGAGAAGAGACAGG - Intergenic
1020222419 7:6250025-6250047 ACAAATGACAGGGAAGAGACTGG - Intronic
1020704169 7:11522196-11522218 TCCAAGGAATAAGAAGAGAAAGG - Intronic
1020733959 7:11922336-11922358 AACAAGGAATGAGGAGATACTGG + Intergenic
1021264345 7:18500870-18500892 ACAAGAGAATGAGATGAGAAAGG + Intronic
1021657063 7:22882900-22882922 AGAAAGGAAAGAGAAGGGAAGGG - Intergenic
1022125245 7:27349902-27349924 ACTAAGGAATTAGAATTGACAGG - Intergenic
1022415153 7:30171162-30171184 ACAAAGAAATGAGTACAGAATGG - Intergenic
1023372950 7:39530172-39530194 AGAAAGGAAGGAGAAGAGGTGGG + Intergenic
1023475227 7:40570488-40570510 AGAATGGAACAAGAAGAGACTGG + Intronic
1023685293 7:42728003-42728025 ACAAAGGTAGGAGAATAGAGAGG - Intergenic
1023691147 7:42789312-42789334 AAAAAGGAGTAAGAAGAGAGAGG + Intergenic
1024210818 7:47201976-47201998 CCAAAGGGTTGAGAAGAGAGAGG - Intergenic
1024518063 7:50277548-50277570 ACAAAGGGATGAGAAGGGAAAGG - Intergenic
1027296519 7:76778602-76778624 AGAAGAGAATGAGAAGAAACAGG + Intergenic
1027388135 7:77678531-77678553 GAAAAGGAATGAGAAGTGAAAGG - Intergenic
1027483857 7:78734508-78734530 ACAAAGGAATGACTACAGAGGGG - Intronic
1027644727 7:80783270-80783292 AGAGAGGTATGTGAAGAGACAGG - Intronic
1028038245 7:86013520-86013542 ACAAAGGTGTGAGATGAGTCCGG - Intergenic
1028333505 7:89624858-89624880 ACCAAGGAAGGAGAAGCCACGGG + Intergenic
1028453933 7:91018106-91018128 ACAAAGGAAGCAAAAGAAACAGG + Intronic
1028527946 7:91805941-91805963 TCAAAGAAATGAAAAGAGAAAGG - Intronic
1028622469 7:92840042-92840064 ACAAAGGAAAAAGAAGATATGGG - Intergenic
1028707533 7:93867612-93867634 GCAAAGGAAAGAGAAGACAAAGG - Intronic
1028823332 7:95238845-95238867 CCAAAGGCATAATAAGAGACAGG - Intronic
1029039267 7:97555981-97556003 ACTAGGGACTGAGAAGAGCCAGG + Intergenic
1029457380 7:100678058-100678080 AGAAAGAAAAGATAAGAGACAGG - Intronic
1029998126 7:105029653-105029675 ACGAAAGAAGGAGAAGAGAATGG + Intronic
1030219921 7:107087741-107087763 AGAAAGTAAGGAAAAGAGACAGG - Intronic
1030364984 7:108635511-108635533 ACAAAGGAAAGAAGAAAGACAGG + Intergenic
1030443477 7:109619234-109619256 ACAAATGCATGAGAATAGATAGG - Intergenic
1030448896 7:109683826-109683848 AAAAAGGAATGGGAGGAGAAAGG - Intergenic
1031114765 7:117655626-117655648 ACAAGGTAATGAGTAGAGGCTGG - Intronic
1031345784 7:120664489-120664511 AGAAAGGAAGGAAAAGAGAATGG + Intronic
1031781407 7:125971295-125971317 ACAAAGGAATGAGGACTGAAAGG + Intergenic
1032016641 7:128384225-128384247 AGAAAGGAAAGAGAAGAGTGGGG - Intergenic
1032507800 7:132449184-132449206 ATACAGGAATGAGTAGAGCCAGG - Intronic
1033307209 7:140233686-140233708 AGAAAGAAAAGAGAAGAGAAGGG - Intergenic
1033420274 7:141199382-141199404 ATAAAGGAATGAAAAGAACCTGG + Intronic
1033744946 7:144306211-144306233 ACAAACGAATAAACAGAGACAGG - Intergenic
1034052212 7:147995508-147995530 ACAAAAGAATTAGAAGAGGCAGG - Intronic
1035121599 7:156572963-156572985 ACCAAAGAAGGGGAAGAGACCGG + Intergenic
1035520169 8:269516-269538 AGACAGGAATATGAAGAGACAGG + Intergenic
1035524036 8:298405-298427 AAAAAGGAATAAGAAGAGGTCGG - Intergenic
1036023725 8:4879162-4879184 ATAAAGGAAGGAGAATAGGCAGG + Intronic
1036505212 8:9348573-9348595 ACAAAGGGAAGATAAGAGAAAGG - Intergenic
1037166372 8:15834095-15834117 AGAAAGTAATGAGGAGAGTCGGG - Intergenic
1037409247 8:18577889-18577911 GCAAAGGTATGAGAGGAGAGAGG - Intronic
1037500969 8:19485278-19485300 ACAAGAGAAAGAGAAGAGTCGGG - Intronic
1037945175 8:22985142-22985164 ACAAAGGAATGAGAAGAGACAGG + Intronic
1038514549 8:28175484-28175506 AAAAAGGAATGTCAATAGACAGG - Intronic
1038609129 8:29043161-29043183 ACAAAGCAATGATGAGATACTGG - Intronic
1038622763 8:29159632-29159654 ACAAAGGAATTAGACTAGAGGGG + Intronic
1039220457 8:35324908-35324930 AAAAAGGCGTGAGGAGAGACTGG + Intronic
1039422057 8:37451419-37451441 ACAAAGAAATGAAAGGTGACTGG - Intergenic
1039465340 8:37781413-37781435 ACACAGGAATGAGGTCAGACAGG + Intergenic
1039505250 8:38047358-38047380 AAAAAGGATTGAGCAAAGACCGG + Intronic
1039712204 8:40067303-40067325 GAAAAGGAAGGAGAAGAGAAGGG - Intergenic
1040984293 8:53277211-53277233 ACAAAGGAATGAAGAAAGATGGG - Intergenic
1041678487 8:60561522-60561544 AAATAGGCATGAGAAGAGAATGG - Intronic
1041800250 8:61790343-61790365 ACAAAGGACTGAGCAGACCCGGG - Intergenic
1042054360 8:64748292-64748314 GAAAAGGAAGGAGAATAGACGGG - Intronic
1042150337 8:65775922-65775944 ACAAAGAAAAGGGAAGAGGCCGG - Intronic
1042679534 8:71367439-71367461 ACAAAGGAATTGCCAGAGACTGG + Intergenic
1043001203 8:74761897-74761919 ACAAAGGAAAGAGAAAGGAGGGG - Intronic
1043508294 8:80924384-80924406 ACATAGAAGGGAGAAGAGACAGG + Intergenic
1043622088 8:82206702-82206724 ACAAAGGAATGAGAAGAGACAGG - Intergenic
1043803836 8:84645851-84645873 ACAAAAGCATGAGAATAGACAGG - Intronic
1043826935 8:84940370-84940392 AGAAGGGAAAGACAAGAGACTGG + Intergenic
1044184994 8:89240234-89240256 ACCAAGGAAGGAGAAGGGGCAGG - Intergenic
1044198484 8:89406529-89406551 ACAAGGGAGAGAGAAGAGACAGG + Intergenic
1045010872 8:97957407-97957429 ACAAAGGAATAAATACAGACTGG - Intronic
1045133864 8:99190872-99190894 ACAAAGAAATGTGAAGAGAATGG - Intronic
1045246527 8:100446014-100446036 AGAAAGGAAAGAAAAGAGAGTGG + Intergenic
1045549785 8:103161219-103161241 ACAAAGGAATCAGAGGAAAGGGG - Intronic
1045817722 8:106296188-106296210 ACAAGGAAATGAGAAGGGACTGG - Intronic
1046867559 8:119167727-119167749 ACAAAGGAGGGAGAAGATACCGG + Intronic
1047161092 8:122380537-122380559 ACAATGGAAAGAGAAGGGAGAGG + Intergenic
1047208792 8:122824104-122824126 ACTAAGTGATGAGATGAGACAGG - Intronic
1047546555 8:125823143-125823165 TCAACTGAATGAGATGAGACAGG - Intergenic
1047729614 8:127716033-127716055 CCACAGGGATGTGAAGAGACAGG - Intergenic
1047797174 8:128269420-128269442 AGAAAGGAGGGAGAAGAGAATGG - Intergenic
1048044582 8:130761310-130761332 ACAAAGGAAGGAATGGAGACTGG + Intergenic
1048169402 8:132091035-132091057 ACAAATGACTAAGAACAGACTGG - Intronic
1048224494 8:132571576-132571598 AGAAAGGGAGGAGAAGAGAGAGG + Intergenic
1048567255 8:135614716-135614738 ACAAAAAAAAGAGTAGAGACAGG + Intronic
1048632445 8:136258822-136258844 CCAAAGGAAAGAGATGAGAAAGG - Intergenic
1048712000 8:137223034-137223056 ATAAATGAATGAGAAGAGAAGGG + Intergenic
1048753826 8:137712315-137712337 ACAAAGAAATGAAAAAAGATGGG - Intergenic
1049842139 8:144779518-144779540 TCAAAGGAATGAGAAAAGACAGG - Intronic
1050337651 9:4605039-4605061 TCAAAGGACTGAGAGAAGACAGG - Intronic
1050757060 9:9017929-9017951 ACAAAGTAGTAAGTAGAGACTGG - Intronic
1051241066 9:15056467-15056489 ACAAAAGAATGTCAAGAGAAGGG - Intergenic
1051283634 9:15470758-15470780 ACAAAGGAATGTCAAGAGAAGGG + Intronic
1051288037 9:15515854-15515876 ACAAAGGAATAAGATGAAGCAGG - Intergenic
1052037307 9:23696990-23697012 ACACAGGACTGAGAAGGTACTGG - Intronic
1054803902 9:69379868-69379890 AGAAAGGAAAGCGAGGAGACAGG - Intronic
1055111642 9:72566033-72566055 ATAAACAAAAGAGAAGAGACAGG + Intronic
1055342439 9:75298509-75298531 ACAAAAGAATGGGAAAAGAAAGG + Intergenic
1055372550 9:75615967-75615989 AGAAAGGAATGAAATGAGATGGG + Intergenic
1055661086 9:78504832-78504854 ACCAAGGAATGAGAACAAATGGG + Intergenic
1055749837 9:79493046-79493068 ACAAAAGGATGAAAAGAGTCTGG - Intergenic
1055913123 9:81373794-81373816 AGAAAGGAATAAGAAGAGATGGG + Intergenic
1055983035 9:82024761-82024783 AAAAAGAAGTGAGAGGAGACGGG + Intergenic
1056121308 9:83491900-83491922 AACAAGAAATGAGAAGAGACAGG + Intronic
1056567968 9:87791553-87791575 GAAGAGGAATGAGAAGAAACTGG + Intergenic
1056593418 9:87984198-87984220 ACAAAGGAATGAGAAGAGACAGG + Intergenic
1056654346 9:88496859-88496881 ACAAGGGAACGTGAAGAGCCAGG - Intergenic
1056780356 9:89544493-89544515 ACCAAGGAGGGAAAAGAGACAGG + Intergenic
1056781304 9:89553185-89553207 ACCTAGGAGAGAGAAGAGACAGG - Intergenic
1057125325 9:92611734-92611756 CCAAAGCAATGAGAAGAAACAGG + Intronic
1057490752 9:95517557-95517579 CCACAGGAATCAGAAGAGAAAGG - Intergenic
1057835200 9:98438924-98438946 AGAAATGAATCAGAAGAGAGTGG - Intronic
1058687616 9:107491577-107491599 ACCTAGGAAAGAGAAGAGAGGGG + Intergenic
1058812709 9:108656766-108656788 AGAAAGGAATGCAAAAAGACAGG + Intergenic
1058857034 9:109072558-109072580 ACAAAGGAATGAGAAGAGACAGG - Intronic
1058872916 9:109218001-109218023 CTAAAGGAACGAGCAGAGACGGG - Intronic
1059020725 9:110573669-110573691 ACGTAGGATTGAGAAGAGCCTGG + Intronic
1059092579 9:111376071-111376093 ATAAAGGTATGTGAAGAGATTGG - Intronic
1059138176 9:111827294-111827316 ATAAAAGGATGAAAAGAGACAGG + Intergenic
1059251929 9:112893581-112893603 ACCAAGGAGGGAGAAGAGAGGGG + Intergenic
1059743632 9:117179612-117179634 TCAAAGGTAAGAGAAGAGATGGG - Intronic
1059834898 9:118140839-118140861 ACAAAGGAGTGGGAAAAGAAAGG - Intergenic
1060379680 9:123155631-123155653 ACACAGTAATGACAAGAGATTGG + Intronic
1060445825 9:123687118-123687140 AGAAAGGAAGAAGGAGAGACGGG + Intronic
1060808666 9:126596133-126596155 ACCAAGCAATGAAAAGACACAGG - Intergenic
1061194753 9:129101760-129101782 ACAAAGGAATGAGAAGAGACAGG - Intronic
1061687012 9:132289497-132289519 ACAAAGAAATGAGAAGAGACAGG - Intronic
1061743962 9:132726298-132726320 AAAAAGGAAGAAGAAGAGAAAGG - Intronic
1203653950 Un_KI270752v1:5659-5681 ACAAACAAAAGAGAAGAAACTGG + Intergenic
1185534422 X:849523-849545 AGAAAGAAAAGAGAAGAGAGAGG - Intergenic
1185659042 X:1712098-1712120 AAAAAAAAATAAGAAGAGACGGG - Intergenic
1185811392 X:3113702-3113724 ACAAAAGAATAAAAAGAGCCGGG - Intergenic
1186841423 X:13488216-13488238 AAAATGGAATGGGGAGAGACAGG + Intergenic
1186905162 X:14102733-14102755 AGAATGCAAGGAGAAGAGACTGG - Intergenic
1187389641 X:18877544-18877566 CCAAAGGAATGAGAAAAGCTTGG - Intergenic
1187995834 X:24925474-24925496 ACAAATGAGAGAGAAAAGACTGG + Intronic
1188157797 X:26762147-26762169 AAAAAAGAATGAGGAGAGAGAGG + Intergenic
1188506830 X:30892036-30892058 ACAAAGGGCTGAGGAGAGAGAGG - Intronic
1188564824 X:31514510-31514532 ATAAGGGAAAGAGAAGAGAAGGG - Intronic
1189034152 X:37479042-37479064 ACCAAGGAAGGAGAAGCCACGGG + Intronic
1189126677 X:38455358-38455380 AGAAAGGTATGGGAAGAGAGTGG - Intronic
1189176993 X:38967482-38967504 AAAAAGGAGAGAGAAGTGACGGG - Intergenic
1189428958 X:40930416-40930438 AGAAAGGAAGGAGAGGAGAGGGG + Intergenic
1189834499 X:45006067-45006089 ACCAAGGAAGGAGAAGCCACAGG - Intronic
1189933363 X:46038742-46038764 ACAAAGGCATGTGAAGAGATGGG + Intergenic
1189951596 X:46237327-46237349 ACAAATGAAAGTGAAGATACAGG + Intergenic
1190397693 X:50001365-50001387 ACAGAGAAATGAGTAGAAACTGG - Intronic
1190556052 X:51636988-51637010 ACAAAGGAATGATAAGAGACAGG - Intergenic
1191851449 X:65588855-65588877 AGAAAGGAATAAGAACAGAGTGG - Intronic
1192929277 X:75787811-75787833 ACAAATGAGTGGGAAGAGATTGG - Intergenic
1193069716 X:77295086-77295108 AAAAAGGAAAGAGAAGCTACAGG + Intergenic
1193227145 X:78997913-78997935 AAAAAAGAATAAGAAGAGTCAGG + Intergenic
1193855050 X:86590302-86590324 ATAAAGGTACTAGAAGAGACTGG - Intronic
1193977146 X:88135187-88135209 AATAAGGAAGGAGAAGAGAAAGG + Intergenic
1194297823 X:92148217-92148239 AAAAAGGAAGGGAAAGAGACAGG - Intronic
1195116359 X:101702751-101702773 ACAAATAAATGAGAACAGAATGG - Intergenic
1195295224 X:103469924-103469946 ATGAAGGAATGAGAAGAGACAGG + Intergenic
1195873249 X:109509106-109509128 ACAAGGAAATGACAAGAGAAAGG + Intergenic
1196692224 X:118572023-118572045 TCAGAGCAGTGAGAAGAGACAGG + Intronic
1196780242 X:119377137-119377159 AGAAAGGAATGAGAAGGCTCAGG + Intergenic
1197149648 X:123206140-123206162 AACAAGGAAAGAGAAGTGACAGG - Intronic
1197698241 X:129573854-129573876 AAAAAGGAATGAGATCAGGCTGG - Intronic
1197814968 X:130488525-130488547 AAAAAGGAATAAGAAGACATTGG + Intergenic
1198187183 X:134264916-134264938 ACAAGGAAATGAGGTGAGACTGG - Intergenic
1198283595 X:135168452-135168474 ACAGAGGAATGAGAAGATGTTGG + Intronic
1198415568 X:136416337-136416359 ATAAAGCAATTAGAAGAGAAGGG - Intronic
1198712290 X:139518229-139518251 ATGAAGGAATGAGAAGAGACAGG - Intergenic
1199278241 X:145971088-145971110 ACCAAGGAAGGAGAAGCCACTGG + Intergenic
1199655958 X:149995746-149995768 ACCAAGGGATGAGAGGAGGCTGG - Intergenic
1200615435 Y:5373180-5373202 AAAAAGGAAGGGAAAGAGACAGG - Intronic
1201346836 Y:12993924-12993946 ATGTAGGAATGAGAAGAGACAGG + Intergenic
1201347482 Y:13000588-13000610 ATGAAGGAATGAGAAGAGATAGG + Intergenic
1201668924 Y:16493228-16493250 ACAAAAGAATGGGAAGAGACAGG - Intergenic
1202133804 Y:21639359-21639381 ACAAAGGAAAGAGAACAGGCAGG - Intergenic