ID: 1013808458

View in Genome Browser
Species Human (GRCh38)
Location 6:114018307-114018329
Sequence CCGAAGTCCGGTGGCAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013808458_1013808464 0 Left 1013808458 6:114018307-114018329 CCTTTGTTGCCACCGGACTTCGG No data
Right 1013808464 6:114018330-114018352 GTACCCTACGAGTGGTGTTGAGG No data
1013808458_1013808467 4 Left 1013808458 6:114018307-114018329 CCTTTGTTGCCACCGGACTTCGG No data
Right 1013808467 6:114018334-114018356 CCTACGAGTGGTGTTGAGGCTGG No data
1013808458_1013808468 21 Left 1013808458 6:114018307-114018329 CCTTTGTTGCCACCGGACTTCGG No data
Right 1013808468 6:114018351-114018373 GGCTGGTCCCCAACACCCTATGG No data
1013808458_1013808469 26 Left 1013808458 6:114018307-114018329 CCTTTGTTGCCACCGGACTTCGG No data
Right 1013808469 6:114018356-114018378 GTCCCCAACACCCTATGGAGAGG No data
1013808458_1013808463 -8 Left 1013808458 6:114018307-114018329 CCTTTGTTGCCACCGGACTTCGG No data
Right 1013808463 6:114018322-114018344 GACTTCGGGTACCCTACGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013808458 Original CRISPR CCGAAGTCCGGTGGCAACAA AGG (reversed) Intergenic
No off target data available for this crispr