ID: 1013808462

View in Genome Browser
Species Human (GRCh38)
Location 6:114018319-114018341
Sequence CTCGTAGGGTACCCGAAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013808462_1013808469 14 Left 1013808462 6:114018319-114018341 CCGGACTTCGGGTACCCTACGAG No data
Right 1013808469 6:114018356-114018378 GTCCCCAACACCCTATGGAGAGG No data
1013808462_1013808467 -8 Left 1013808462 6:114018319-114018341 CCGGACTTCGGGTACCCTACGAG No data
Right 1013808467 6:114018334-114018356 CCTACGAGTGGTGTTGAGGCTGG No data
1013808462_1013808468 9 Left 1013808462 6:114018319-114018341 CCGGACTTCGGGTACCCTACGAG No data
Right 1013808468 6:114018351-114018373 GGCTGGTCCCCAACACCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013808462 Original CRISPR CTCGTAGGGTACCCGAAGTC CGG (reversed) Intergenic
No off target data available for this crispr