ID: 1013808467

View in Genome Browser
Species Human (GRCh38)
Location 6:114018334-114018356
Sequence CCTACGAGTGGTGTTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013808456_1013808467 20 Left 1013808456 6:114018291-114018313 CCTGTCTCTTCTCATTCCTTTGT 0: 23
1: 18
2: 19
3: 67
4: 652
Right 1013808467 6:114018334-114018356 CCTACGAGTGGTGTTGAGGCTGG No data
1013808458_1013808467 4 Left 1013808458 6:114018307-114018329 CCTTTGTTGCCACCGGACTTCGG No data
Right 1013808467 6:114018334-114018356 CCTACGAGTGGTGTTGAGGCTGG No data
1013808462_1013808467 -8 Left 1013808462 6:114018319-114018341 CCGGACTTCGGGTACCCTACGAG No data
Right 1013808467 6:114018334-114018356 CCTACGAGTGGTGTTGAGGCTGG No data
1013808461_1013808467 -5 Left 1013808461 6:114018316-114018338 CCACCGGACTTCGGGTACCCTAC No data
Right 1013808467 6:114018334-114018356 CCTACGAGTGGTGTTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013808467 Original CRISPR CCTACGAGTGGTGTTGAGGC TGG Intergenic
No off target data available for this crispr