ID: 1013808468

View in Genome Browser
Species Human (GRCh38)
Location 6:114018351-114018373
Sequence GGCTGGTCCCCAACACCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013808461_1013808468 12 Left 1013808461 6:114018316-114018338 CCACCGGACTTCGGGTACCCTAC No data
Right 1013808468 6:114018351-114018373 GGCTGGTCCCCAACACCCTATGG No data
1013808458_1013808468 21 Left 1013808458 6:114018307-114018329 CCTTTGTTGCCACCGGACTTCGG No data
Right 1013808468 6:114018351-114018373 GGCTGGTCCCCAACACCCTATGG No data
1013808465_1013808468 -5 Left 1013808465 6:114018333-114018355 CCCTACGAGTGGTGTTGAGGCTG No data
Right 1013808468 6:114018351-114018373 GGCTGGTCCCCAACACCCTATGG No data
1013808466_1013808468 -6 Left 1013808466 6:114018334-114018356 CCTACGAGTGGTGTTGAGGCTGG No data
Right 1013808468 6:114018351-114018373 GGCTGGTCCCCAACACCCTATGG No data
1013808462_1013808468 9 Left 1013808462 6:114018319-114018341 CCGGACTTCGGGTACCCTACGAG No data
Right 1013808468 6:114018351-114018373 GGCTGGTCCCCAACACCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013808468 Original CRISPR GGCTGGTCCCCAACACCCTA TGG Intergenic
No off target data available for this crispr