ID: 1013808695

View in Genome Browser
Species Human (GRCh38)
Location 6:114020445-114020467
Sequence CTCCTGCAGCGCCCAGATGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 165}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013808695 Original CRISPR CTCCTGCAGCGCCCAGATGT CGG Intergenic
900644640 1:3703364-3703386 CTCAGGCAGGGCCCCGATGTCGG - Intronic
901060932 1:6471631-6471653 CTCCCGCCGCGCCCAGGTGGAGG - Exonic
901440279 1:9273507-9273529 CTGCTGCAGCGTCCAGCAGTGGG - Intergenic
901737553 1:11322038-11322060 CTCCTGCACCAGCCAGCTGTGGG + Intergenic
903028012 1:20443295-20443317 GTCCTGCAGTCCCCAGATGGGGG - Intergenic
905870552 1:41401715-41401737 CTTCAGCAGCGTCCAGGTGTGGG - Intergenic
909677947 1:78258261-78258283 CTCCTGCAGGGCACAGAACTGGG + Intergenic
914303258 1:146394162-146394184 TTCCTACAGCGCCCAGAAGAAGG + Intergenic
914753764 1:150551975-150551997 CCCCTACAGGGCCCAGAGGTGGG + Intronic
915341094 1:155177250-155177272 CTCCTCCAGCTCACAGATCTGGG - Exonic
918003066 1:180515954-180515976 CTCCAGCAGTGCCCAGAAGACGG - Intergenic
920194390 1:204217180-204217202 CACCTGCAGGGGCCTGATGTGGG - Intergenic
920668309 1:207982919-207982941 CTCCTGCATCCCTCAGAAGTGGG + Intergenic
922141606 1:222893738-222893760 CTCCGGGAGCTCCTAGATGTGGG + Intronic
923010457 1:230083970-230083992 CTCCATCAGCACCCGGATGTTGG + Intronic
1065936218 10:30522755-30522777 CTCCTGCAGCGCCCCCAGGCTGG + Intergenic
1066456714 10:35578615-35578637 CTCCTGCAACTCCCTGATGTAGG + Intergenic
1067393291 10:45885883-45885905 CCCCTGAGGAGCCCAGATGTTGG + Intergenic
1067861613 10:49855013-49855035 CCCCTGAGGAGCCCAGATGTTGG + Intronic
1068925174 10:62528108-62528130 CTCCTGCAGGCCCCAGAAGATGG - Intronic
1069755369 10:70771509-70771531 CACCTGCAGCTCCCAGGTGGGGG - Intronic
1070985663 10:80687676-80687698 CTCCAGCAGGGCCCAGAAGCAGG - Intergenic
1071522835 10:86341555-86341577 CTCCTGCGGCTCCCAGAGCTAGG + Intronic
1072190197 10:93072064-93072086 TTCCTGCAGTGGCCAGAGGTTGG + Intergenic
1074546901 10:114408326-114408348 GTCATGCAGCCCTCAGATGTGGG + Intergenic
1075608176 10:123831381-123831403 GTCCTGGAGCTCCCAGCTGTAGG - Intronic
1075645332 10:124092868-124092890 CCCCTGCACCGCCCAGCTCTGGG - Intronic
1076601275 10:131658524-131658546 CTCCTGGAGGGCACAGAGGTGGG + Intergenic
1076814920 10:132909883-132909905 CTCAGTCAGAGCCCAGATGTGGG + Intronic
1079299258 11:19262929-19262951 CCCCTGCAGAGCCCAGAGGAGGG + Intergenic
1084681108 11:70666959-70666981 CTCCTGCTGCAAGCAGATGTTGG - Intronic
1086431401 11:86740142-86740164 CTCCTCCAATACCCAGATGTGGG + Intergenic
1089256336 11:117196279-117196301 CCCCTGGAACCCCCAGATGTTGG + Exonic
1090475048 11:127012803-127012825 CTCCAGCCTCGCCCAAATGTAGG + Intergenic
1097158208 12:57027959-57027981 CTGCTGCAGGCCCCAGCTGTGGG + Intronic
1098923829 12:76327690-76327712 CTCCTGGAGCTCCCAGAAGCTGG + Intergenic
1099127261 12:78777789-78777811 CACCTGCAGGACCCTGATGTGGG - Intergenic
1101889275 12:108697766-108697788 CTCCTGGAGGGCACAGATGCTGG + Intronic
1103230843 12:119329078-119329100 ACCCTGCAGAGCCCAGATGAGGG - Intergenic
1105745676 13:23375356-23375378 CGCCTGCCGCGCCGCGATGTGGG - Intronic
1111528760 13:89509251-89509273 CTTCTGCAGAGACCAGAGGTGGG - Intergenic
1112048448 13:95621179-95621201 GTCCTGCAGCTCCCAGTTTTCGG - Intronic
1113955480 13:114098120-114098142 CCCCTGCAGCCCCCAGACTTGGG - Intronic
1114674407 14:24430879-24430901 CTCCAGCTGCAGCCAGATGTGGG - Exonic
1121578257 14:95006650-95006672 CTCCTGCTGTCCCCAGATCTAGG - Intergenic
1122144164 14:99679257-99679279 CTCCCTCAGCGGCCAGCTGTAGG - Exonic
1122366002 14:101195157-101195179 CTCCTGCAGCTCCCAGGTTTGGG - Intergenic
1122481412 14:102049790-102049812 CTCCTCCAGGGACCAGCTGTTGG - Exonic
1122641149 14:103160436-103160458 CTCCTCCAGGGCCCAGATGCTGG + Intergenic
1122697029 14:103560682-103560704 CTCTTGCACCGCACAGATTTTGG + Exonic
1125543808 15:40488245-40488267 CTGCTGCAGAGCCCAGTGGTGGG - Intergenic
1128411914 15:67407997-67408019 CTCCTCCAGTCCCCAGATGGTGG - Intronic
1129910552 15:79222673-79222695 ATCCCGCAGCGTCCAGATGCGGG + Intergenic
1130013094 15:80167301-80167323 CGCCTGCAGCCCCCAGAAGCTGG - Intronic
1130400280 15:83546174-83546196 CTCCTGCAGCCCCCAGTTCCAGG - Intronic
1131107251 15:89743687-89743709 CCCCAGCAGGGCCCAGATGATGG + Intergenic
1136020603 16:27437524-27437546 CTCCTGCAGCCTCCACAGGTCGG + Exonic
1136450747 16:30353180-30353202 CTTCACCAGCGCCCAGATGCAGG - Exonic
1139323755 16:66135584-66135606 ATCCAGCAGCTCCCAGAGGTAGG + Intergenic
1143379792 17:6488875-6488897 TCCCTGCAGTGCCCAGATTTGGG + Intronic
1144778494 17:17796515-17796537 CTCCAGCAGCCCCCAGAAGGAGG + Exonic
1146485164 17:33236837-33236859 CTCCTGCAGCCACCAGAAGCTGG + Intronic
1147567083 17:41544381-41544403 CTCCTGCAGGGCCCAGGCCTGGG - Intergenic
1148560708 17:48604348-48604370 TCCCTGCAGCGCCCAGAGGTGGG + Intronic
1148615596 17:48997826-48997848 CTCCTACAGCGGCCAGTTCTTGG + Exonic
1151698620 17:75730930-75730952 CTCCAGCAGCTCCACGATGTTGG - Exonic
1152111511 17:78359835-78359857 CCCGCGCTGCGCCCAGATGTTGG + Exonic
1152482753 17:80566169-80566191 CTCCTGCATAGCGCAGCTGTAGG + Intronic
1152662259 17:81547993-81548015 CCCCTGCGTGGCCCAGATGTGGG - Intronic
1153433964 18:5048902-5048924 CTGCTGCAGCACACAGCTGTTGG - Intergenic
1155231440 18:23778782-23778804 CTCCTGCAGCGCCACGGTGTGGG + Intronic
1157802000 18:50628296-50628318 CTCCTAAAGCGATCAGATGTTGG - Intronic
1161818456 19:6515074-6515096 CTCCGGCACCACCAAGATGTTGG - Intergenic
1162022316 19:7873536-7873558 CTCCCGCAGCTCCCAGAACTCGG + Exonic
1162508919 19:11105380-11105402 CACCTGCATCCCCCAGCTGTGGG + Exonic
1163545999 19:17941901-17941923 CTCCTGCAGGGCCCTGGTCTCGG - Intronic
1163716284 19:18874265-18874287 CTCCTACATGGGCCAGATGTAGG + Intronic
1163850012 19:19657395-19657417 CTCTTGCAGGGCCGAGATGGTGG - Exonic
1164423571 19:28119434-28119456 CCCCTGCAGGGTCCAGATGGAGG + Intergenic
1164920664 19:32086268-32086290 CTCATGCAGGGCCCAGGTGTGGG + Intergenic
1164992219 19:32692526-32692548 GTTGTGCAGCGCCCAGATGTCGG - Exonic
1165309887 19:35023456-35023478 CTTCTGCAGCGCCAGGATCTCGG - Exonic
1167013043 19:46821627-46821649 CTCTTGCAGGGGCCAGAAGTAGG + Intergenic
1167219235 19:48186752-48186774 CCCCTGCAGCTCCCAGAAGCTGG - Intronic
1167707369 19:51089565-51089587 CTCCTGCACCTACCAGCTGTGGG - Intergenic
1168291854 19:55361035-55361057 CTCCAGCTGCGACCAGATGAGGG + Exonic
927191693 2:20521522-20521544 CTCCTGAAGCCACCAGATGCTGG + Intergenic
927917005 2:26943690-26943712 CTCCTGCAACTCTCTGATGTAGG + Intronic
927964820 2:27262350-27262372 CTCCAGCCGCGGCCAGCTGTGGG - Intronic
931474792 2:62576627-62576649 CACCTCCAGCTCTCAGATGTAGG - Intergenic
931844221 2:66185929-66185951 TTCCTGCATGGCCCAGATTTGGG - Intergenic
932305935 2:70704376-70704398 CTGTCGCAGGGCCCAGATGTTGG + Exonic
932481412 2:72041730-72041752 CTCCTGAAACTCCCACATGTTGG + Intergenic
935457044 2:103282320-103282342 CTCCTGCAGTGCCCAGAGCTTGG + Intergenic
937442818 2:121931372-121931394 TCCCTGCAGCTCCCAGATGCTGG + Intergenic
938814719 2:134889317-134889339 CACTTACAGCGCCCAGATCTTGG + Intronic
938981878 2:136534840-136534862 CTCCTGCAGCGCCCACAGAGAGG + Intergenic
943669923 2:190649256-190649278 CTCCTGCAGCCGCCAGAGGAGGG + Exonic
946155042 2:217801750-217801772 CTGGTGCAGGGCCCAGAGGTGGG + Exonic
946411100 2:219515546-219515568 CTGCTGCAGTGCCCAGGTCTGGG + Intronic
947961109 2:234238224-234238246 CTACTGCAGTGCCCATATGGTGG + Intergenic
1168918987 20:1515535-1515557 CTCCTGCAGCCACCAGAGGAAGG - Intergenic
1173813103 20:45968284-45968306 ATCCTACAGGGCCCAGATGATGG - Exonic
1174762241 20:53217287-53217309 CTCCCTGAGCGCCCAGAAGTGGG - Intronic
1179812375 21:43880285-43880307 CCCCTGCCGCTCCCAGATCTCGG - Intronic
1180729853 22:17973130-17973152 CTCCTTCACCACCCAGATGGGGG + Intronic
1180970018 22:19810430-19810452 CTCCTGCAGCGCCCAGAGTGGGG - Intronic
1181812387 22:25411667-25411689 CACCTGGAGCCCCCAGAAGTTGG + Intergenic
1183387772 22:37525026-37525048 CTCCTGCAGGGGCCAGAGGAAGG + Intergenic
1183618057 22:38956892-38956914 TTTCTGCAGGGCCCAGAGGTGGG + Intronic
953055393 3:39383749-39383771 CTGCTGCAACCCCAAGATGTCGG + Exonic
954009130 3:47619487-47619509 CTCCTGCAGTCCTCAGCTGTGGG - Intronic
954238317 3:49274138-49274160 TTCCTGCAGCCCCCAGGTGGGGG + Exonic
963085501 3:141431760-141431782 CTCCAGCAGCTTCCCGATGTTGG + Intronic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
973931211 4:55794352-55794374 CTCCAGGAGGGCCCAGATGCAGG - Intergenic
985721627 5:1492652-1492674 TTCCTGCTGCGCCGAGATGAAGG + Intronic
985965359 5:3335461-3335483 CTCCTGCAGCCCCCCGTTGTGGG - Intergenic
985996452 5:3599889-3599911 CTCCGCCAGCGACCAGATCTTGG - Exonic
987376660 5:17241755-17241777 CTCCTGCAGAGCACAGTTGAAGG - Intronic
990400160 5:55429733-55429755 CTGCGGCAGCACCCAGCTGTGGG - Intronic
1000939529 5:167343321-167343343 CACATCCAGCACCCAGATGTTGG - Intronic
1001600363 5:172924314-172924336 CTCCTAGAGCGCCCAGCTGGTGG + Intronic
1002096060 5:176831625-176831647 CTCCTGCAGTGCCCAGAGCGGGG + Intronic
1002455941 5:179345396-179345418 CTCCAGCTGCCCCCAGATGTGGG - Exonic
1002571284 5:180140641-180140663 CTCATGCAGAGGCCAGAGGTGGG - Intronic
1005847640 6:29793602-29793624 CCCCTACAGAGCCCAGATATTGG - Intergenic
1006143248 6:31943586-31943608 CTCCTGCAGGGGCCAGAGGCTGG - Intronic
1006631851 6:35435844-35435866 CTCCTGGAGGGCACAGACGTAGG + Intergenic
1011210107 6:84946065-84946087 CTCCTGCAGCATCTAGCTGTGGG - Intergenic
1012371168 6:98509094-98509116 ATCCTGCAGCACCTAGATCTTGG - Intergenic
1013207612 6:107958600-107958622 CTCCTCCAGCCCCCATATTTTGG + Intergenic
1013808695 6:114020445-114020467 CTCCTGCAGCGCCCAGATGTCGG + Intergenic
1016922232 6:149307065-149307087 CTCCTCCAGCCCCAAGATCTGGG + Intronic
1017720970 6:157242892-157242914 CCCCTGCAGGTCCCACATGTGGG + Intergenic
1018317157 6:162568549-162568571 CTCCTGCACGGCCTGGATGTTGG - Intronic
1019287332 7:230260-230282 CTCCTGGAGCCCCCAGAGCTGGG + Intronic
1019520465 7:1458616-1458638 CTCCTGCTGCTCCCAGAGATGGG + Intronic
1019535890 7:1529840-1529862 TTCCTGCAGCGCTCAGAGGGGGG + Intergenic
1019644527 7:2121883-2121905 CCCGTGCAGCAGCCAGATGTGGG + Intronic
1022107934 7:27210184-27210206 TCCCTGGAGCGCCCATATGTAGG - Intergenic
1022370025 7:29761758-29761780 CTTCTCCTGCTCCCAGATGTTGG + Intergenic
1022685107 7:32589776-32589798 CTCCTGGAGCACATAGATGTAGG + Intergenic
1030016566 7:105228778-105228800 CTCTCGCAGCGCCCAGGTGAGGG - Intronic
1031438840 7:121767322-121767344 CTCCTGCAGCTTCCAGATGCAGG - Intergenic
1035617511 8:1013028-1013050 TTCCTGCAGCTCACAGATGCTGG + Intergenic
1037591220 8:20313552-20313574 CTCCTGGAGGGGCCAGATCTAGG + Intergenic
1041196394 8:55405932-55405954 CTCCTGTGGGGTCCAGATGTTGG - Intronic
1041721038 8:60975551-60975573 TTCCTGGAGCCCCCAGATGCAGG + Intergenic
1041936202 8:63334749-63334771 CCCCTGCAGGCCCCAGATGGAGG - Intergenic
1053281880 9:36825819-36825841 CTGCTGCAGGGCCCAGGTGCTGG + Intergenic
1060153878 9:121305700-121305722 CTCCAGCTGGGCCCAGATTTGGG + Intronic
1060198981 9:121640830-121640852 CTTCTGCAGTTCCCAGTTGTGGG + Intronic
1061572901 9:131488614-131488636 CTCCTGCAGCCCCCAGACGGGGG + Intronic
1061860893 9:133468331-133468353 CTCCTGCAGAGCCCAGACTGAGG + Exonic
1062569347 9:137177897-137177919 CTCCTGGAGCCCCCAGAAGCTGG + Intronic
1185551131 X:983234-983256 ATCCTGAAGCCTCCAGATGTCGG + Intergenic
1190172367 X:48121790-48121812 CTCCTGCACCTGCCAGCTGTAGG - Intergenic
1190180142 X:48184989-48185011 CTCCTGCACCTGCCAGCTGTAGG + Intergenic
1190183975 X:48219082-48219104 CTCCTGCACCTGCCAGCTGTAGG - Intronic
1190189907 X:48268535-48268557 CTCCTGCACCTGCCAGCTGTAGG - Intronic
1190193154 X:48294208-48294230 CTCCTGCACCTGCCAGCTGTAGG + Intergenic
1190197129 X:48329225-48329247 CTCCTGCACCTGCCAGCTGTAGG - Intergenic
1190199127 X:48345188-48345210 CTCCTGCACCTGCCAGCTGTGGG + Intergenic
1190204826 X:48394470-48394492 CTCCTGCACCTGCCAGCTGTGGG - Intergenic
1190205710 X:48400933-48400955 CTCCTGCACCTGCCAGCTGTGGG + Intergenic
1190658653 X:52635036-52635058 CTCCTGCACCTGCCAGCTGTAGG - Intergenic
1190659663 X:52642820-52642842 CTCCTGCACCTGCCAGCTGTAGG + Intergenic
1190663868 X:52679603-52679625 CTCCTGCACCTGCCAGCTGTAGG - Intronic
1190665890 X:52695656-52695678 CTCCTGCACCTGCCAGCTGTAGG + Intronic
1190673528 X:52762754-52762776 CTCCTGCACCTGCCAGCTGTAGG - Intronic
1190675554 X:52778819-52778841 CTCCTGCACCTGCCAGCTGTAGG + Intronic
1190677069 X:52791525-52791547 CTCCTGCACCTGCCAGGTGTAGG - Intergenic
1193499763 X:82261202-82261224 CTCCCTTAGCTCCCAGATGTAGG - Intergenic
1195582898 X:106528811-106528833 CTCTTTCAGCTCCCAGATGCAGG + Intergenic
1196763606 X:119223082-119223104 GTGGTGCAGCGCCCAGATATCGG + Intergenic
1200708725 Y:6465030-6465052 CTCCTGCATTGCCAAGATGCAGG + Intergenic
1201025387 Y:9699679-9699701 CTCCTGCATTGCCAAGATGCAGG - Intergenic
1201748194 Y:17403455-17403477 CTCCTGAATAGCCCAGAAGTTGG - Intergenic