ID: 1013814588

View in Genome Browser
Species Human (GRCh38)
Location 6:114082945-114082967
Sequence CCCTTCCCCTCCCTTGTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013814579_1013814588 29 Left 1013814579 6:114082893-114082915 CCAACAGGGGAACAACACAGCAG No data
Right 1013814588 6:114082945-114082967 CCCTTCCCCTCCCTTGTCCAAGG No data
1013814585_1013814588 0 Left 1013814585 6:114082922-114082944 CCACATGTGTCAGGGATAAGAAC No data
Right 1013814588 6:114082945-114082967 CCCTTCCCCTCCCTTGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013814588 Original CRISPR CCCTTCCCCTCCCTTGTCCA AGG Intronic