ID: 1013815752

View in Genome Browser
Species Human (GRCh38)
Location 6:114095410-114095432
Sequence TCAGCCCTGAAGAAAGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 257}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013815752_1013815759 12 Left 1013815752 6:114095410-114095432 CCCATGCCTTTCTTCAGGGCTGA 0: 1
1: 0
2: 2
3: 31
4: 257
Right 1013815759 6:114095445-114095467 GCTCACATGAATATGGGAGAGGG 0: 1
1: 0
2: 3
3: 31
4: 491
1013815752_1013815760 15 Left 1013815752 6:114095410-114095432 CCCATGCCTTTCTTCAGGGCTGA 0: 1
1: 0
2: 2
3: 31
4: 257
Right 1013815760 6:114095448-114095470 CACATGAATATGGGAGAGGGAGG 0: 1
1: 0
2: 6
3: 189
4: 3068
1013815752_1013815758 11 Left 1013815752 6:114095410-114095432 CCCATGCCTTTCTTCAGGGCTGA 0: 1
1: 0
2: 2
3: 31
4: 257
Right 1013815758 6:114095444-114095466 TGCTCACATGAATATGGGAGAGG No data
1013815752_1013815761 16 Left 1013815752 6:114095410-114095432 CCCATGCCTTTCTTCAGGGCTGA 0: 1
1: 0
2: 2
3: 31
4: 257
Right 1013815761 6:114095449-114095471 ACATGAATATGGGAGAGGGAGGG 0: 1
1: 0
2: 3
3: 41
4: 446
1013815752_1013815762 19 Left 1013815752 6:114095410-114095432 CCCATGCCTTTCTTCAGGGCTGA 0: 1
1: 0
2: 2
3: 31
4: 257
Right 1013815762 6:114095452-114095474 TGAATATGGGAGAGGGAGGGAGG 0: 1
1: 0
2: 5
3: 84
4: 931
1013815752_1013815756 5 Left 1013815752 6:114095410-114095432 CCCATGCCTTTCTTCAGGGCTGA 0: 1
1: 0
2: 2
3: 31
4: 257
Right 1013815756 6:114095438-114095460 ACAAGATGCTCACATGAATATGG 0: 1
1: 0
2: 0
3: 11
4: 152
1013815752_1013815757 6 Left 1013815752 6:114095410-114095432 CCCATGCCTTTCTTCAGGGCTGA 0: 1
1: 0
2: 2
3: 31
4: 257
Right 1013815757 6:114095439-114095461 CAAGATGCTCACATGAATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013815752 Original CRISPR TCAGCCCTGAAGAAAGGCAT GGG (reversed) Intronic
900967224 1:5967088-5967110 CCAGCCCTGAGGGAGGGCATTGG - Intronic
902078227 1:13803943-13803965 TCAGCCCTGAGGGAGGCCATGGG - Intronic
903430001 1:23289148-23289170 TCAGGCTTGAAGAAGGACATAGG - Intergenic
904441182 1:30532941-30532963 GCAGCCCTGAAGAAAAGCAGTGG - Intergenic
904623292 1:31788519-31788541 TCAGGCCCGAAGAAAGTCACCGG + Intergenic
905003783 1:34694359-34694381 TCAGCCCTGAAGGGAGGATTGGG - Intergenic
907006095 1:50915545-50915567 TTTGCCCTGAAGAAAGGCTCAGG + Intronic
908381809 1:63604050-63604072 TAAGCCCGGTAGAAAGGCACAGG - Intronic
909390582 1:75116372-75116394 TCAACCCTGAAAATAGGGATAGG - Intergenic
911051919 1:93678768-93678790 TGAGACCTGAAAAAAGGCAAGGG + Intronic
911701670 1:100960350-100960372 TCTGCCCTGAAGAAGGGCACAGG - Intronic
912353325 1:109035317-109035339 TTATCTCTGAAGAAAGGCATGGG + Intronic
913495337 1:119423340-119423362 TCATCTTTGGAGAAAGGCATAGG - Intergenic
914096155 1:144545935-144545957 TGAGCCCCGAAGAAAGACAGGGG + Intergenic
914302367 1:146388027-146388049 TGAGCCCCGAAGAAAGACAGGGG - Intergenic
916488027 1:165276717-165276739 TCAGACCTGAAGAGAGGAGTTGG + Intronic
917478183 1:175386686-175386708 TGAGCCCTGAGGAAAGACCTAGG + Intronic
917564023 1:176192791-176192813 TCACCCCTGAATAATGGGATGGG - Intronic
919837505 1:201585140-201585162 TCATCCCTGAAGTCAGGCACTGG + Intergenic
920144144 1:203843712-203843734 TCAGCCATTTAAAAAGGCATAGG - Intronic
920666702 1:207967973-207967995 ACATCCCTGAAGAGAGGCAGTGG - Intergenic
1063383694 10:5602553-5602575 ACAGCTCTGGAGAAAGGCCTTGG - Intergenic
1065961624 10:30738501-30738523 GAAGCCCTGTAGGAAGGCATGGG - Intergenic
1066492211 10:35904584-35904606 TCAGCCCAGGAAATAGGCATGGG - Intergenic
1068401264 10:56530707-56530729 TCAGTCTTCAAGAAAGTCATAGG - Intergenic
1068587454 10:58815092-58815114 AAAACCCTGAAAAAAGGCATTGG - Intronic
1070372026 10:75791731-75791753 TCAGCCCTGGAGAAAGGGCTGGG + Intronic
1072255906 10:93620076-93620098 TCAAGCATGGAGAAAGGCATAGG + Intronic
1073398931 10:103241185-103241207 AAAGCCCTGATGAAATGCATTGG + Intergenic
1075229301 10:120659636-120659658 TCAGCCTGGAAGAAATGAATTGG - Intergenic
1075841552 10:125508908-125508930 TCTGCCCTGAAGTAAGGAATGGG - Intergenic
1075873222 10:125786239-125786261 ACAGCCCTATAGAAAGGCCTTGG - Intronic
1077809827 11:5625699-5625721 TGAGACCTGCAGAAAGACATAGG - Intronic
1078056359 11:8012226-8012248 TCAGCAAAGAAGAAAGGCTTTGG - Intergenic
1078949478 11:16113477-16113499 TTAACCCTGAAGAAAAGCACCGG + Intronic
1079899152 11:26159686-26159708 TCAGCACTGAACATAAGCATGGG - Intergenic
1080130888 11:28793059-28793081 TCAGGCCTGAAGAAGTGCTTTGG + Intergenic
1085270091 11:75265139-75265161 CCAGCCCTGGAGAATGGCAGGGG + Exonic
1086412036 11:86552971-86552993 TCAACCCAGAGGAAGGGCATGGG - Intronic
1087153981 11:94883301-94883323 TCAGCCCTGATGTAAGGTAAAGG - Intergenic
1088591406 11:111406783-111406805 GCAGACCTGAAGCAAGGCGTTGG + Intronic
1090848191 11:130547418-130547440 TGAGACCTGAAAAATGGCATCGG - Intergenic
1091365893 11:135020083-135020105 TCAGCCCTGGGGAAAGGAAGTGG - Intergenic
1092539111 12:9408670-9408692 TCAGCCCTGACGAAGGGGCTAGG - Intergenic
1093108606 12:15120816-15120838 TCAGCCATGAGGAAAGGAAGTGG - Intronic
1093138010 12:15475008-15475030 TCAGCCATGAAAATAAGCATTGG - Intronic
1094142837 12:27198533-27198555 ACAGCCCAAAAGAAAGGCAATGG - Intergenic
1094524955 12:31225376-31225398 GCAGCCCTGAGGAAGGGCCTTGG - Intergenic
1095992771 12:48048665-48048687 GCAGCCTTAAAGGAAGGCATGGG - Intronic
1097057025 12:56256556-56256578 TCAGCCCTGAAGACAGGGAAAGG - Intronic
1097956468 12:65491498-65491520 GCAGCCCTGAAGAAAGATAGAGG - Intergenic
1100656926 12:96656747-96656769 TCATCCCAGAAATAAGGCATAGG + Intronic
1102412907 12:112735757-112735779 TCAGAACTGAAGAAAGGCTTGGG - Intronic
1103844701 12:123893295-123893317 GAAGCTCTGAAGCAAGGCATGGG + Exonic
1103848967 12:123918659-123918681 TGAGACCTGAAGAAAAGCACAGG - Exonic
1104029489 12:125054078-125054100 TCAGGCCAGAAGAAAGGGAAAGG - Intergenic
1104444231 12:128820936-128820958 GGATCCCTGAAGAAAGGCTTGGG + Intronic
1105545489 13:21347866-21347888 TCAGTCCTGATAAATGGCATAGG - Intergenic
1105634316 13:22202703-22202725 TCAGGCCTGAAGAAGGGCAGTGG - Intergenic
1106330134 13:28732429-28732451 TCAGCCCTGAAAAAAGTCTCAGG + Intergenic
1106373010 13:29155222-29155244 TCAGCCTTGAAGAGATGCGTGGG + Intronic
1110809908 13:79800867-79800889 TTAGCCCTGAAGAAAGGTAGAGG + Intergenic
1112022744 13:95385724-95385746 TCAGCCCTGAAAACAGGGAGAGG - Intergenic
1113043073 13:106125411-106125433 TGAGCCCTGGAGTAAGTCATAGG - Intergenic
1114502690 14:23182793-23182815 GTAGCCCTGAAGAAAGAGATCGG - Exonic
1114544673 14:23490089-23490111 GCAGGCCTGAAGAAAGGCAGTGG + Intronic
1115069571 14:29304450-29304472 GCAGCCCTGAAAAAAGGATTTGG + Intergenic
1115848499 14:37566199-37566221 TCATCCTTGATGAAAGGCTTAGG - Intergenic
1115976845 14:39005766-39005788 TCATCCCTGAAGTCAGGCACTGG + Intergenic
1119363509 14:74071564-74071586 TCAGCCCTGAGGACAGGAAGTGG + Intronic
1120073255 14:80126600-80126622 TCATCCCTGAAGTGGGGCATAGG + Intergenic
1122208648 14:100160781-100160803 TGAGCCAGGAAGGAAGGCATGGG + Intergenic
1122311988 14:100803261-100803283 TCAGCCCTGTAGCCAGCCATGGG - Intergenic
1123045716 14:105512865-105512887 TCAGCCCCAAAGAAAGGAAAAGG - Intergenic
1123493227 15:20799452-20799474 TCAGCCCTGGACTAAGGCACCGG + Intergenic
1123549734 15:21368554-21368576 TCAGCCCTGGACTAAGGCACCGG + Intergenic
1127112950 15:55693940-55693962 TAAGGCCTGAATAAAGGCAAAGG + Intronic
1127404121 15:58623252-58623274 TCAGCCCAGAAGAAAGGATCTGG + Intronic
1128568264 15:68715290-68715312 CCAGCCCCGCAGAAAGGCCTAGG + Exonic
1130145803 15:81272987-81273009 TCAGCCCTGAACAAAGGGATTGG - Intronic
1130614334 15:85390343-85390365 ACAGACCTGAAGAAAGTCAAGGG + Intronic
1202958065 15_KI270727v1_random:95772-95794 TCAGCCCTGGACTAAGGCACCGG + Intergenic
1133689288 16:8197622-8197644 TCAGCCATGAAAGACGGCATAGG + Intergenic
1137574123 16:49587181-49587203 TCAGACCTAAAGGAACGCATGGG - Intronic
1138352319 16:56352556-56352578 ACAGCCCTGGAGTAAGGCTTTGG + Intronic
1139336132 16:66232619-66232641 ACAGCCATCAACAAAGGCATTGG + Intergenic
1140761945 16:78117518-78117540 TCAGGTCTGAAGAAAGGAAGAGG + Intronic
1140803296 16:78508771-78508793 TCAGCCCTGTGGAGAGACATCGG - Intronic
1142441973 16:90104520-90104542 TCAGCCCTCTAACAAGGCATAGG - Intergenic
1142666995 17:1468893-1468915 TCTGCCCTGATTACAGGCATTGG - Intronic
1143364414 17:6396528-6396550 CCAAGGCTGAAGAAAGGCATTGG + Intronic
1146626638 17:34440093-34440115 TCAGCTCAGGAGAAAGGCAGTGG - Intergenic
1146771860 17:35576140-35576162 TCAGCTCTGAAGAAAGCTGTTGG - Exonic
1147559317 17:41499285-41499307 TCAGTGCTGATGAAAGGCAGAGG - Intergenic
1147949552 17:44099386-44099408 TCAGCCCTGCAGAAAACCAGAGG - Intronic
1148983906 17:51604120-51604142 ACAGCAGTGAAGAGAGGCATGGG - Intergenic
1150673610 17:67224130-67224152 ACAGCCCTGAACACAGGGATTGG + Intronic
1151423409 17:74013850-74013872 TCAGCCTTGTAGATAAGCATGGG + Intergenic
1153329391 18:3857803-3857825 TCAGAACTGGAGAAAGGCACTGG - Intronic
1154450779 18:14473989-14474011 TCAGCCCTGGACTAAGGCACCGG + Intergenic
1154451033 18:14474920-14474942 TGCGCCCTGGACAAAGGCATGGG + Intergenic
1155094426 18:22542391-22542413 TCAGGCTTGAACAAAGGCTTTGG + Intergenic
1155359704 18:24987882-24987904 TCATTCCTGAAGAAGGGCTTTGG - Intergenic
1156128433 18:33937221-33937243 TCAGCCCTGAAGCAAGCCAGTGG - Intronic
1156134108 18:34015697-34015719 TCAGCTCTGAAGAAAGGTACAGG - Intronic
1156291048 18:35748750-35748772 TCTTCCCTGAAGCAAGTCATAGG + Intergenic
1156870568 18:41940459-41940481 GCAGGCCTGAGGAAAGGGATAGG + Intergenic
1157057329 18:44246239-44246261 GCAGCCCTGATGAAAGGGACAGG + Intergenic
1157202794 18:45673225-45673247 GCTGCCCTCAAGAAAGGCTTTGG + Intronic
1157276285 18:46313208-46313230 CGAGCCCTGAAGAAAGGTGTGGG - Intergenic
1157913221 18:51639008-51639030 TCTCCCCTGAAGAAATGCATAGG - Intergenic
1158734331 18:60062554-60062576 CCAGCTCTGAAGCATGGCATGGG + Intergenic
1160340078 18:78082196-78082218 TCAACCCTGAAGAAATGTGTGGG + Intergenic
1160419410 18:78733909-78733931 TCAGCCCTGGAGCCCGGCATAGG - Intergenic
1160433237 18:78826739-78826761 AGAGCCGGGAAGAAAGGCATTGG - Intergenic
1160602419 18:80023883-80023905 TCATCTCTGAAGAAAAGCATAGG + Intronic
1161837248 19:6656236-6656258 TCAGCCCCGAAGAAGGGGCTAGG + Intergenic
1165235259 19:34415684-34415706 TCAGCACTGAACAAAGGAAAAGG + Intronic
1165251106 19:34535746-34535768 TCATCTCTGAAGACAGGCATTGG - Intergenic
1165399344 19:35587954-35587976 TCCCCCCTCCAGAAAGGCATTGG + Intergenic
1165911423 19:39230640-39230662 TCAGCTCTGAAGAAAGGTAAAGG - Intergenic
1167863065 19:52300603-52300625 TCGGCACTGAGGGAAGGCATAGG - Intronic
925160106 2:1677641-1677663 TCAGCCCTCGAGGAAGGCCTGGG - Intronic
925655346 2:6141803-6141825 TCAGCACAGGAGAAAGACATAGG + Intergenic
925707967 2:6707702-6707724 TCATCTGTGAAGAAAGGCAGTGG - Intergenic
927436258 2:23069131-23069153 GGGGCCCTGAAGAAAGGCAGTGG - Intergenic
927701094 2:25269439-25269461 TCAACCCTGAAGAATGGACTGGG + Intronic
928166422 2:28975868-28975890 TCAGCAATGAGGAAAGGCATAGG - Intronic
935077191 2:99756477-99756499 TCAGACCAGAAGGAAGGCAACGG - Intronic
936238466 2:110766956-110766978 TCAGCCTTGCAGAAAGGAATTGG + Intronic
938662483 2:133502097-133502119 TAAGCCCAGAAGAAAGTCTTGGG + Intronic
938772732 2:134514059-134514081 GCAGCCCTTAAGTAAGCCATAGG + Intronic
939187517 2:138878342-138878364 TGAGCCCGGAAGAAACTCATTGG + Intergenic
939256902 2:139756219-139756241 TTAGCCCTAAAGAAAGAGATAGG - Intergenic
943473362 2:188323300-188323322 TCAGCACAGAAGAAAGGCATGGG + Intronic
944165232 2:196711714-196711736 TCAGACCAGAAGAATGGAATGGG - Intronic
947949215 2:234133542-234133564 GGAGCCCTCAAGATAGGCATTGG + Intergenic
947995697 2:234525415-234525437 TGAGCAATGAAGAAAGGCTTTGG + Intergenic
948529783 2:238597074-238597096 CCAGCCCTGAACAGAGGCTTGGG + Intergenic
1169302775 20:4458738-4458760 ACAACCCAGAAGAAAGGCAAAGG + Intergenic
1169392708 20:5203314-5203336 TCAGGCCTGGGGAAAGGCCTGGG + Intergenic
1169860788 20:10150036-10150058 TGAGCCTTGATGAAAGCCATAGG + Intergenic
1170564323 20:17588123-17588145 TCATCTTTGCAGAAAGGCATAGG + Intronic
1172464827 20:35148391-35148413 TCAGCCCTGTAGAATGTCTTGGG + Intergenic
1173947374 20:46962523-46962545 TCAGCCCTGGAGAAAGAGAGGGG + Intronic
1175342721 20:58244591-58244613 TGAGCTCTGAAGAAAGCTATGGG + Intergenic
1176445451 21:6816585-6816607 TCAGCCCTGGACTAAGGCACGGG - Intergenic
1176823619 21:13681618-13681640 TCAGCCCTGGACTAAGGCACGGG - Intergenic
1176957670 21:15124954-15124976 TCAACACAGAAGAAAGACATTGG + Intergenic
1178378930 21:32092383-32092405 TGAGCCCTGAGCAAGGGCATGGG - Intergenic
1179332736 21:40421119-40421141 TCAGCCATGAAGAAAGACAGAGG + Intronic
1179391312 21:40994611-40994633 ACAGCCCTGAAGAAAAGCTGAGG + Intergenic
1183508735 22:38223107-38223129 TCAGCCCTCAGGATAGGCTTAGG - Intronic
1184321572 22:43745811-43745833 TCAACCCAGAAGAAAGGAAGGGG + Intronic
1184551209 22:45205118-45205140 TTAGCCTTGCAGAAAGGCATGGG - Intronic
950281752 3:11713952-11713974 TCAGCCCTGCAGGAGGGCAGGGG + Intronic
950504426 3:13385561-13385583 ACAGCCCTGGAGAAGGGCAGTGG + Intronic
950617929 3:14177442-14177464 TCAGCCCTGGTAAAAGCCATGGG + Intronic
950927541 3:16757403-16757425 TCAGCGCTAAAGAGAGGAATAGG - Intergenic
951777639 3:26326652-26326674 TCAGCCCTGGAGGGGGGCATGGG + Intergenic
953250764 3:41244393-41244415 TCATCCCTGAAGAGAGCCAGTGG + Intronic
954135502 3:48580339-48580361 GCTGCCCTGCAGAAAGGCAGGGG + Exonic
954462734 3:50636956-50636978 AAAGCCCTGAAAATAGGCATAGG - Intronic
955004165 3:54953848-54953870 GCAGACCTGAGGAAAGGCCTGGG + Intronic
955645542 3:61133678-61133700 GGAGCCCTGAAGAAAGCCAGAGG + Intronic
955942174 3:64157062-64157084 TCTGCACTGAAGAAAGCCATAGG - Intronic
956960126 3:74390002-74390024 ACAGATCTGAAGAAAGGCAAAGG - Intronic
957190529 3:77003479-77003501 GTGGCCGTGAAGAAAGGCATGGG - Intronic
957446792 3:80323455-80323477 TTAGCTTTGAAGAAAGGCAATGG + Intergenic
957531971 3:81452005-81452027 TGTGCCCTGAAGAAAGACTTGGG + Intergenic
958732411 3:97972945-97972967 ACAGCCCATAAGAAAGCCATGGG - Intergenic
959511377 3:107216660-107216682 TCAGCTGTTAAGAAAGGAATAGG + Intergenic
961565771 3:127762400-127762422 ACAGCCCTTAAGAAAGGCTGGGG - Intronic
963737086 3:149030709-149030731 TCATCCCTGCAGAAAGGTCTTGG + Exonic
964307124 3:155353894-155353916 TCAGCCATGAAGCAAGCAATTGG + Intergenic
964673469 3:159252242-159252264 TCTGACCTGTAGAAAGGCAGAGG - Intronic
965146314 3:164909961-164909983 TCATACCTTAAAAAAGGCATAGG + Intergenic
965301303 3:167008545-167008567 TTAACCCTGAAGAAATGCATTGG + Intergenic
965937401 3:174131154-174131176 TTAGCCTTGGAGAAAGGCAAGGG - Intronic
966350448 3:179028556-179028578 TATGCTCTGAAGAAAGGCTTAGG + Intronic
966720773 3:183061013-183061035 TCTGCCCTGATGAATGGAATTGG - Intronic
968276318 3:197443106-197443128 TCATACATGAGGAAAGGCATAGG - Intergenic
968362241 3:198155486-198155508 TCAGCCCTCTAACAAGGCATAGG - Intergenic
972059383 4:34850263-34850285 TCATCTCTGAATAAAGGCAGTGG + Intergenic
975337674 4:73199155-73199177 TTAGCCATGAAGAAAGGCTCAGG - Intronic
975442084 4:74422403-74422425 TCAGCCCTCAAGAAAAGAAGAGG + Intergenic
978578717 4:110211747-110211769 TGAGGCCTCAAGAAAGGCATGGG + Intergenic
980086427 4:128395040-128395062 AGAGCCCTGAAGTCAGGCATTGG - Intergenic
980484830 4:133442647-133442669 TCAGCTGTGAAGAGATGCATAGG + Intergenic
981633461 4:146848539-146848561 TCAGAGCTGATCAAAGGCATTGG - Intronic
982196013 4:152915166-152915188 TCAGCTCTTAAGAAAAGCACGGG + Intronic
982551236 4:156802120-156802142 TCATCGTTGGAGAAAGGCATGGG + Intronic
984010509 4:174365937-174365959 TAAGCTGTGAAGAAAAGCATAGG - Intergenic
985535967 5:465945-465967 TCAGCCCTGCAGCACGGCAAGGG + Intronic
987824842 5:23017193-23017215 TCCGCCCTGTAGAAAGCAATAGG - Intergenic
988036855 5:25838141-25838163 TCAGCTTTGAAGCCAGGCATTGG + Intergenic
989566883 5:42909817-42909839 GCAGGCCTGCAGAAAGGCAGGGG + Intergenic
992005514 5:72473617-72473639 TCAGCCGGGAAGAATGGAATGGG - Intronic
992015363 5:72569888-72569910 TCAGCTCTGAAGACAGGGATTGG - Intergenic
992163747 5:74027963-74027985 TCTGCTCTGAAGAATGGCCTTGG - Intergenic
993519419 5:88882837-88882859 TCAGCCTTCAAAAAAGGCACAGG + Intronic
994683318 5:102917199-102917221 TCAGCCCTGAAGATAGTCAGTGG + Intronic
995526121 5:113051965-113051987 TTAGCCTTCAAGAAAGTCATAGG + Intronic
995585459 5:113643697-113643719 TCAGCACTGAAGGCAGGGATTGG + Intergenic
995976444 5:118041754-118041776 TTATCACTAAAGAAAGGCATTGG - Intergenic
996646565 5:125825088-125825110 TCAGCCCTAAAGCAAGGGACAGG - Intergenic
997716741 5:136048224-136048246 GCAACCCAGAAGAAAAGCATGGG - Intronic
998031273 5:138870669-138870691 TCAGCCCTGAAGGACAGCAGAGG - Exonic
998930278 5:147173863-147173885 TCAGTCCTGAACCCAGGCATGGG - Intergenic
1000925466 5:167188290-167188312 CCCGCGCTGAAGAACGGCATTGG - Intergenic
1001276035 5:170352357-170352379 TCAGCTCTGAAAAGAGGCCTGGG - Intergenic
1001954203 5:175837224-175837246 TTAGCTCTGAAGAAAGGCCTCGG + Intronic
1006266741 6:32931862-32931884 ACTGCCTTGAAGCAAGGCATGGG - Intergenic
1007327003 6:41070241-41070263 TCAACACTGAAGAAGGGAATAGG + Intronic
1010906066 6:81490631-81490653 TCAGCCCTCAAGGAAGGCACTGG + Intergenic
1011295643 6:85824756-85824778 TCAGCCTTGATGAAATGCTTGGG + Intergenic
1011402849 6:86982517-86982539 TCAGCCCTGAAGAGGGGTCTGGG + Intronic
1011972085 6:93237821-93237843 TTAGGAATGAAGAAAGGCATGGG + Intergenic
1012028396 6:94027662-94027684 TCTGCTTAGAAGAAAGGCATGGG + Intergenic
1012208320 6:96489217-96489239 GCAGACCTGCAGAAAGGCTTAGG + Intergenic
1013728561 6:113133499-113133521 TAAGCCAAGGAGAAAGGCATAGG + Intergenic
1013815752 6:114095410-114095432 TCAGCCCTGAAGAAAGGCATGGG - Intronic
1014036363 6:116770776-116770798 GCAGCCCTGAGGCCAGGCATAGG + Intergenic
1015366648 6:132403108-132403130 TCAGCCATGAAGAAAGGAAGGGG + Intergenic
1017662308 6:156686954-156686976 TCAGCCCTGAGGAAAAAGATAGG - Intergenic
1018183367 6:161243678-161243700 TCAGCCCGGGAGAGAGGCAGGGG - Intronic
1018474781 6:164129896-164129918 CCAGCCCAGCTGAAAGGCATTGG + Intergenic
1018735187 6:166682482-166682504 ACAGCCCTGGGGAAAGGCAGGGG + Intronic
1019253440 7:33221-33243 TCAGCCCTCTAACAAGGCATAGG + Intergenic
1020690903 7:11353504-11353526 TCAGCAGTGGAGAAATGCATTGG + Intergenic
1021090431 7:16476723-16476745 TTATCTCTGAAGAATGGCATTGG - Intronic
1021492938 7:21239685-21239707 GCAGGCCTGGGGAAAGGCATAGG - Intergenic
1023485636 7:40683376-40683398 CCTGCCCTGAAGAAAGGAAGGGG - Intronic
1023815796 7:43949106-43949128 TCAGCCCTGAAGGAAGATACAGG + Intronic
1025605718 7:63038637-63038659 TGAGCCCTGAGGAGAGGCCTGGG + Intergenic
1026343422 7:69453568-69453590 TCATCCCAGAAGAAAGTCCTGGG - Intergenic
1027481782 7:78706767-78706789 CCAGCCCTGAAACAATGCATAGG + Intronic
1029609104 7:101617167-101617189 TGAGCACTGAAGAAAGGAAGGGG - Intronic
1029733872 7:102454868-102454890 CCAGCCCTGCAGAAACACATGGG + Exonic
1033782302 7:144685524-144685546 CCAGAACTGAAGAAAGTCATGGG - Intronic
1035376323 7:158409271-158409293 CCAGCCCTGAACACAGGCAATGG - Intronic
1036572215 8:9990480-9990502 CCAGCCCTGAATTAAGACATGGG - Intergenic
1036653346 8:10659998-10660020 TCAGCCCTGCAGTAAGGACTTGG - Intronic
1037082270 8:14802153-14802175 TCAGCACTCTAGAAAGGCAAGGG + Intronic
1038644755 8:29352162-29352184 TCCGCCCGGAACAAAGGCATGGG - Intergenic
1039083657 8:33758711-33758733 AAAGCCTTGAAGAAAAGCATAGG - Intergenic
1040883123 8:52230072-52230094 TCACTCCTGAGGAAAAGCATCGG + Exonic
1040907258 8:52481157-52481179 GCACCCCAGAAAAAAGGCATTGG - Intergenic
1040963837 8:53064356-53064378 AAAGCCATGAAGAAAGGCTTGGG + Intergenic
1043269982 8:78320481-78320503 GCAGCAGTGAATAAAGGCATGGG + Intergenic
1043949344 8:86290755-86290777 TCTGCCGTGCAGAAAGGCAGGGG - Intronic
1045406995 8:101876567-101876589 TCAGCCCTGAAAGCTGGCATTGG - Intronic
1045530228 8:102977618-102977640 TTAGCCCTGGAGAAAGGAAAAGG + Intronic
1046100473 8:109608490-109608512 ACTGCCCAGAAGAAAGGAATAGG + Intronic
1047554984 8:125919615-125919637 TCAGCCCTCCAGAAATGCCTGGG - Intergenic
1051749267 9:20324556-20324578 TCAGCCCTGAAGGACCTCATGGG - Intergenic
1052983500 9:34467195-34467217 TCAGCCCTGAATGAAAGCATTGG - Intronic
1053034890 9:34816644-34816666 TCAGCCCTCATGAATGGGATTGG - Intergenic
1053094633 9:35314146-35314168 TCAGCACAGAAGAAAGCCACTGG - Intronic
1053274569 9:36773412-36773434 TGGGTCCTGAAGAAAGGAATGGG + Intergenic
1054721568 9:68609255-68609277 TCTGCCCTGAAGTACAGCATGGG - Intergenic
1056321514 9:85439724-85439746 TCAGCACTGAAGAGAGACACTGG + Intergenic
1057944036 9:99309105-99309127 TCAGTCCAGATGAAAGTCATGGG + Intergenic
1058128204 9:101220843-101220865 TCTACCCTGGAGCAAGGCATAGG + Intronic
1058985965 9:110208392-110208414 TCAGCCCTAAAGTCAGCCATGGG + Intergenic
1059345762 9:113626855-113626877 AAAGCTCTGTAGAAAGGCATAGG - Intergenic
1059430617 9:114248144-114248166 TCAGCCCTCGAGGCAGGCATTGG - Intronic
1060245648 9:121943927-121943949 TCAGACATGAAGAAAGAAATGGG - Intronic
1060277211 9:122191395-122191417 TCTGCCCTGATGGAAGGAATTGG + Intronic
1061994830 9:134178084-134178106 TCAGCCCCGATGAAACGCACAGG + Intergenic
1062042871 9:134412159-134412181 GCAGCCCTGGAGAAAGCTATGGG + Intronic
1062419827 9:136475026-136475048 TCAGTCCTGGAGAGAGGCTTTGG - Exonic
1062441651 9:136572403-136572425 CCCGCCCTGCAGAAAGGCACTGG - Intergenic
1062746931 9:138219148-138219170 TCAGCCCTCTAACAAGGCATAGG - Intergenic
1203523744 Un_GL000213v1:67940-67962 TCAGCCCTGGACTAAGGCACGGG + Intergenic
1186988253 X:15039563-15039585 TCAGACCTTAATAAAGGCTTTGG - Intergenic
1187137441 X:16561669-16561691 TAAGCACTAAAGAAAGGCAGGGG + Intergenic
1187830608 X:23377304-23377326 TAAGCACTGAAGAAAGACTTTGG - Intronic
1187849697 X:23579517-23579539 TCATCCCTGAAATAAGGTATAGG + Intergenic
1188609055 X:32073097-32073119 TTAGCCTTTAAGAAAGACATGGG + Intronic
1190024838 X:46913114-46913136 TCAGCCCCGAAGCCAGGCAAAGG - Intronic
1192181872 X:68921240-68921262 GCAGCCTTGAAGAAAGCCACAGG - Intergenic
1192472768 X:71413632-71413654 GGAGCCCTGAAGAGAGGTATGGG - Intronic
1193956074 X:87864502-87864524 TCAACCCTGCAGAAAAGAATTGG - Intergenic
1196236953 X:113292979-113293001 CCAGAATTGAAGAAAGGCATGGG + Intergenic
1197329732 X:125138887-125138909 TCATCCCTGGAGAAAGGGATGGG - Intergenic
1197622573 X:128767159-128767181 TCAGCAGTGAAAAAAGGCAGTGG - Intergenic
1197649444 X:129048850-129048872 AAATCCGTGAAGAAAGGCATTGG - Intergenic
1197814617 X:130484315-130484337 TGACTCCTGAACAAAGGCATTGG - Intergenic
1198056658 X:133002403-133002425 TAATCCCTGAAGAAAGCTATGGG - Intergenic
1201326251 Y:12762372-12762394 TCAGTCAAGAGGAAAGGCATAGG + Intronic