ID: 1013815753

View in Genome Browser
Species Human (GRCh38)
Location 6:114095411-114095433
Sequence ATCAGCCCTGAAGAAAGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 306}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013815753_1013815762 18 Left 1013815753 6:114095411-114095433 CCATGCCTTTCTTCAGGGCTGAT 0: 1
1: 0
2: 1
3: 24
4: 306
Right 1013815762 6:114095452-114095474 TGAATATGGGAGAGGGAGGGAGG 0: 1
1: 0
2: 5
3: 84
4: 931
1013815753_1013815761 15 Left 1013815753 6:114095411-114095433 CCATGCCTTTCTTCAGGGCTGAT 0: 1
1: 0
2: 1
3: 24
4: 306
Right 1013815761 6:114095449-114095471 ACATGAATATGGGAGAGGGAGGG 0: 1
1: 0
2: 3
3: 41
4: 446
1013815753_1013815756 4 Left 1013815753 6:114095411-114095433 CCATGCCTTTCTTCAGGGCTGAT 0: 1
1: 0
2: 1
3: 24
4: 306
Right 1013815756 6:114095438-114095460 ACAAGATGCTCACATGAATATGG 0: 1
1: 0
2: 0
3: 11
4: 152
1013815753_1013815760 14 Left 1013815753 6:114095411-114095433 CCATGCCTTTCTTCAGGGCTGAT 0: 1
1: 0
2: 1
3: 24
4: 306
Right 1013815760 6:114095448-114095470 CACATGAATATGGGAGAGGGAGG 0: 1
1: 0
2: 6
3: 189
4: 3068
1013815753_1013815758 10 Left 1013815753 6:114095411-114095433 CCATGCCTTTCTTCAGGGCTGAT 0: 1
1: 0
2: 1
3: 24
4: 306
Right 1013815758 6:114095444-114095466 TGCTCACATGAATATGGGAGAGG No data
1013815753_1013815759 11 Left 1013815753 6:114095411-114095433 CCATGCCTTTCTTCAGGGCTGAT 0: 1
1: 0
2: 1
3: 24
4: 306
Right 1013815759 6:114095445-114095467 GCTCACATGAATATGGGAGAGGG 0: 1
1: 0
2: 3
3: 31
4: 491
1013815753_1013815757 5 Left 1013815753 6:114095411-114095433 CCATGCCTTTCTTCAGGGCTGAT 0: 1
1: 0
2: 1
3: 24
4: 306
Right 1013815757 6:114095439-114095461 CAAGATGCTCACATGAATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013815753 Original CRISPR ATCAGCCCTGAAGAAAGGCA TGG (reversed) Intronic
900576446 1:3384927-3384949 AGGAGCCCAGCAGAAAGGCAGGG - Intronic
902078228 1:13803944-13803966 ATCAGCCCTGAGGGAGGCCATGG - Intronic
903021775 1:20400025-20400047 ATCTGCTCTGTAGGAAGGCAGGG - Intergenic
905617356 1:39410123-39410145 ATCTGCCCTCCAGAAAGGCCTGG - Intronic
905694072 1:39962198-39962220 ATCAGGCCTAAGGAAGGGCAAGG - Intronic
906775048 1:48521606-48521628 ATCAGCCTTGCAGAAGAGCAAGG + Intergenic
907223696 1:52926235-52926257 ATCATCTTTGGAGAAAGGCACGG - Intronic
908044674 1:60155618-60155640 AGCAGCCCTGAAAAAAGGTAGGG + Intergenic
911051918 1:93678767-93678789 ATGAGACCTGAAAAAAGGCAAGG + Intronic
911815650 1:102346481-102346503 ATCTTCCCTGAAGACAAGCAGGG + Intergenic
912353324 1:109035316-109035338 ATTATCTCTGAAGAAAGGCATGG + Intronic
912472687 1:109916398-109916420 ATCACTCCAGAAGAAAGCCAAGG + Intronic
912659094 1:111512821-111512843 ATCAGCCCTTCAGAAACACAGGG - Intronic
913697684 1:121343567-121343589 ATCAGCCCTGGAGGAAAGCCAGG + Intronic
914096154 1:144545934-144545956 GTGAGCCCCGAAGAAAGACAGGG + Intergenic
914139872 1:144936484-144936506 ATCAGCCCTGGAGGAAAGCCAGG - Intronic
914302368 1:146388028-146388050 ATGAGCCCCGAAGAAAGACAGGG - Intergenic
914342393 1:146771267-146771289 ATCAGCCCTGGGTGAAGGCAGGG - Intergenic
914517374 1:148385400-148385422 CTGAGCCCTGAACAAAGACAAGG + Intergenic
914793041 1:150896219-150896241 ATCAACATAGAAGAAAGGCAGGG + Intergenic
918118554 1:181517517-181517539 ATCAACTCTGAGGAAAGCCATGG + Intronic
918444853 1:184607227-184607249 AGAAGCCCAGAAGAGAGGCAGGG - Intronic
919837416 1:201584714-201584736 ATCAGCCCTGCTGACAGGCTGGG + Intergenic
920205211 1:204286358-204286380 AGCAGCCGTGAAGAAAGACTGGG + Intronic
920485076 1:206362217-206362239 ATCAGCCCTGGAGGAAAGCCAGG + Intronic
922643342 1:227259058-227259080 TACAGCACTGAAGAAAGTCAAGG - Intronic
922962585 1:229661491-229661513 GTCAGCCTTGAAGGAAGGGAAGG + Intergenic
922968825 1:229716995-229717017 ATAACCCCTGGAGAAAGGCAGGG - Intergenic
923300519 1:232636243-232636265 ATCAGCACTGCAGAAAGACCTGG - Intergenic
1065259688 10:23911702-23911724 TTCAACCTTGAAAAAAGGCAAGG - Intronic
1069748282 10:70729915-70729937 ATCATCCCTGAAAGCAGGCAGGG + Intronic
1070372025 10:75791730-75791752 ATCAGCCCTGGAGAAAGGGCTGG + Intronic
1072255710 10:93618481-93618503 ATCAGCATTGCATAAAGGCAAGG - Intronic
1072299385 10:94044564-94044586 ATCAACACTGAAGAGAGCCATGG - Intronic
1073607751 10:104913380-104913402 ATCTGCGTTGTAGAAAGGCAAGG + Intronic
1074915594 10:117951842-117951864 TTCAGAGGTGAAGAAAGGCAGGG - Intergenic
1075605079 10:123799070-123799092 CCCAGCCAGGAAGAAAGGCATGG + Intronic
1075761792 10:124863170-124863192 GCCAGCCCTGAAGAAATGGATGG + Intergenic
1075841553 10:125508909-125508931 ATCTGCCCTGAAGTAAGGAATGG - Intergenic
1076464594 10:130670191-130670213 CTCACCCCTGAAGACAAGCATGG - Intergenic
1076501917 10:130943878-130943900 ATAAACCCTGTGGAAAGGCATGG + Intergenic
1077868408 11:6241357-6241379 CTGAGCCCTGAAGGAAGGGATGG + Intronic
1079118589 11:17658313-17658335 ATCTTCTCTGAAGAAATGCATGG - Intergenic
1080188348 11:29519016-29519038 CTGAGCCCTGAACAAAGACAGGG - Intergenic
1080189592 11:29527872-29527894 CTGAGCCCTGAACAAAGACAGGG - Intergenic
1080692893 11:34573891-34573913 AGAGGCCCGGAAGAAAGGCAGGG - Intergenic
1081485003 11:43520745-43520767 AGCAGCCCTGAAGGATGACAAGG - Intergenic
1083179280 11:60973899-60973921 ATCAGCCCCGGAGAGGGGCAAGG - Intronic
1083878348 11:65536473-65536495 ATCAGGCCTGGAGAAAGGAGGGG + Intronic
1084980996 11:72828713-72828735 ATCGGCCCTGAGGACAGACAGGG - Exonic
1085023709 11:73224466-73224488 ATCAGGCCTGGAGGAAGCCAAGG - Intronic
1085270089 11:75265138-75265160 TCCAGCCCTGGAGAATGGCAGGG + Exonic
1085488140 11:76886153-76886175 ATAAGCCCTGAAGAATGAGATGG + Intronic
1085961934 11:81470969-81470991 ATCATGAGTGAAGAAAGGCAGGG + Intergenic
1086959614 11:92969236-92969258 ATCAGTTGTCAAGAAAGGCAAGG - Intergenic
1087262502 11:96026513-96026535 ATCACCTCTGAAGGAAGGGAGGG - Intronic
1088174865 11:107040983-107041005 CTGAGCCCTGAACAAAGACAGGG - Intergenic
1088451051 11:109981693-109981715 ATAAGCCCTGGAGAAATACATGG - Intergenic
1090884261 11:130862080-130862102 TTTAGCCATCAAGAAAGGCAAGG - Intergenic
1091097207 11:132835222-132835244 ATGTGCCCAGGAGAAAGGCATGG - Intronic
1092115188 12:5996066-5996088 TGCAGCCCTGGAGCAAGGCAGGG - Exonic
1092587433 12:9913635-9913657 ATCAGCACTCAAGAAAGCAAAGG + Exonic
1094365150 12:29672219-29672241 ATGAGCCCTAAAGACAGGGATGG - Intronic
1095377167 12:41543917-41543939 ATCAGCCCTGAACAAACACATGG + Intronic
1095992772 12:48048666-48048688 AGCAGCCTTAAAGGAAGGCATGG - Intronic
1097069234 12:56342810-56342832 CTCTACCCTGAAGAAAGGGATGG - Exonic
1098077244 12:66745321-66745343 ATCAAAGCTGAAGAAAGACAAGG + Intronic
1098136744 12:67410955-67410977 AACAGCTGTGAACAAAGGCAGGG + Intergenic
1100176406 12:92035854-92035876 ATCAGATCTGAAGGAAGGGAGGG - Intronic
1100815250 12:98380778-98380800 ATCTGCCCTACAGAAAGGAATGG + Intergenic
1102412908 12:112735758-112735780 GTCAGAACTGAAGAAAGGCTTGG - Intronic
1102509930 12:113408292-113408314 ATCATCTATGGAGAAAGGCAAGG + Intronic
1104788117 12:131464209-131464231 ACCAGCACTGAAGGCAGGCAGGG + Intergenic
1107053090 13:36073658-36073680 ATCAGCCCTCCAGACAGCCAAGG + Intronic
1108504367 13:51097865-51097887 ATCAGCCCTGAAGTAGCCCAGGG + Intergenic
1111061460 13:83024551-83024573 ATCTGCCCTTAGGAAAAGCAGGG - Intergenic
1112068690 13:95823518-95823540 ATCAGCAGTGAAAAAAGACAAGG - Intronic
1114673022 14:24422889-24422911 ATCAGCACTTAAGAGATGCAGGG + Intergenic
1118960067 14:70521682-70521704 AACAGCTGTGAAAAAAGGCAAGG - Intergenic
1119418918 14:74494374-74494396 ATCAACCCCGACGACAGGCAAGG + Exonic
1120577634 14:86203433-86203455 GTTAGCCCTGAGAAAAGGCAGGG - Intergenic
1121398078 14:93645284-93645306 ATGAGCTTTGAAGAAAAGCAAGG + Intronic
1123186082 14:106518228-106518250 ATCAGCCTTGAGGAAACTCAGGG - Intergenic
1123497955 15:20849245-20849267 CTGAGCCCTGAACAAAGACAGGG - Intronic
1123555186 15:21422872-21422894 CTGAGCCCTGAACAAAGACAGGG - Intronic
1123591431 15:21860204-21860226 CTGAGCCCTGAACAAAGACAGGG - Intergenic
1124025696 15:25963609-25963631 AAGAGCCTTGAAGAAAGTCAAGG - Intergenic
1125503526 15:40253544-40253566 ATCAGACCTGAAGATGGGCCCGG - Intronic
1125507828 15:40277242-40277264 AGCAGCCCTGAAGTGGGGCAGGG - Exonic
1125679976 15:41524389-41524411 CTCAGCCCTAAAGAATGGAAAGG + Intronic
1125920175 15:43520712-43520734 ATCAGCTCTGAGGTAAGGCCAGG + Exonic
1127018364 15:54715268-54715290 ATCATTCCTGAGGAAAGACAAGG - Intergenic
1128752941 15:70161887-70161909 ATGAGCCCTGTAGCCAGGCAGGG - Intergenic
1129657260 15:77532446-77532468 ATCCGTCCTGAAAGAAGGCAGGG + Intergenic
1130199411 15:81811081-81811103 CTCAGGGCTAAAGAAAGGCACGG - Intergenic
1130614333 15:85390342-85390364 AACAGACCTGAAGAAAGTCAAGG + Intronic
1131595195 15:93791480-93791502 ATCACCCCAGAAGAAAGGGCAGG - Intergenic
1202963532 15_KI270727v1_random:150082-150104 CTGAGCCCTGAACAAAGACAGGG - Intergenic
1133630059 16:7611864-7611886 ATCTGCTCTGAAGACTGGCACGG - Intronic
1135235064 16:20747485-20747507 CTGAGCCCTGAACAAAGACAGGG - Intronic
1137354926 16:47752524-47752546 ATCAGCACTCAAGAAGGGCTTGG + Intergenic
1138263065 16:55639441-55639463 CTCAGCCCTGCAGAGAGCCAGGG - Intergenic
1138862112 16:60771189-60771211 CTGAGCCCTGAACAAAGACAGGG + Intergenic
1139991881 16:70946153-70946175 ATCAGCCCTGGGTGAAGGCAGGG + Intronic
1141147833 16:81544070-81544092 ATCAGCCCAGAAGAGGGGAAAGG + Intronic
1141274890 16:82578399-82578421 AACTGCACTGATGAAAGGCATGG - Intergenic
1143288399 17:5809736-5809758 CTGAGCCCTGAACAAAGACAGGG - Intronic
1145262021 17:21360153-21360175 TTCAGCCCTGAACAGAGACAAGG - Intergenic
1145956222 17:28856649-28856671 ATCAGCCTTGAAGAAAATGATGG + Intronic
1146425781 17:32736932-32736954 ATCAAACCTCCAGAAAGGCAGGG - Intronic
1146443489 17:32917237-32917259 ATCTGCCAAGCAGAAAGGCAGGG - Intergenic
1146682936 17:34821577-34821599 ATCCTCCATGAAGAAAGGCTGGG + Intergenic
1148236745 17:45974237-45974259 AGCAGCCCTGAAGTAGGGCCCGG - Intronic
1148983907 17:51604121-51604143 AACAGCAGTGAAGAGAGGCATGG - Intergenic
1150431332 17:65120158-65120180 CTAAGGCCTGAAGAAAGGGAGGG + Intergenic
1150620351 17:66803367-66803389 AGCAGCCCAGTAGGAAGGCAAGG + Intronic
1152867438 17:82732581-82732603 ATCAGCCCAGAGGAGAGGCGTGG - Intergenic
1153640291 18:7150783-7150805 GTGACCTCTGAAGAAAGGCAGGG - Intergenic
1153762251 18:8342605-8342627 ATAAGACATGTAGAAAGGCAAGG - Intronic
1154455952 18:14525666-14525688 CTGAGCCCTGAACAAAGACAGGG - Intronic
1156331525 18:36128649-36128671 ATCCTCCCTGGAGAAAGGCTCGG - Intronic
1158734329 18:60062553-60062575 ACCAGCTCTGAAGCATGGCATGG + Intergenic
1159796518 18:72851020-72851042 AGCAGCCCTGAATAGAGGGATGG + Intronic
1160532292 18:79572530-79572552 ATCAGCCCTGAAGGAGGACCTGG + Intergenic
1161900313 19:7113856-7113878 ACCTGCCCTGGAGAAAGGTAGGG - Intronic
1163766857 19:19168196-19168218 ATCATCCCTGGGGAAGGGCAGGG - Intronic
1164908073 19:31983875-31983897 AGGACCCCTGGAGAAAGGCAGGG + Intergenic
925748417 2:7064855-7064877 AGCAGCCCTGAAGACAGACCTGG + Intronic
928201801 2:29251920-29251942 AACAGACCTGCAGCAAGGCAGGG + Intronic
929520675 2:42647593-42647615 AGTAGCCTTGAAGAAAGGAAAGG - Intronic
930007355 2:46908892-46908914 ATCATCCTTGAAGAATGTCAAGG + Intronic
930303983 2:49654422-49654444 ATCAGTCTTAAGGAAAGGCAGGG + Intergenic
932443682 2:71757015-71757037 ATCAGCCAAGATGAAAGGGAAGG + Intergenic
934012266 2:87835550-87835572 CTGAGCCCTGAACAAAGACAGGG + Intergenic
934102802 2:88668894-88668916 CTGAGCCCTGAAGGAAGGGAAGG - Intergenic
935849356 2:107201529-107201551 ATCAGCCCGCCAGGAAGGCAGGG + Intergenic
936117246 2:109711993-109712015 ATCAGCCCCGATGACAGGGAAGG - Intergenic
936991128 2:118367310-118367332 AACAGCTCTGAAGAAATTCAAGG - Intergenic
937442916 2:121932170-121932192 ATCATCCCTGTTGAAATGCATGG + Intergenic
938284788 2:130102861-130102883 CTGAGCCCTGAACAAAGACAGGG - Intronic
938335429 2:130491421-130491443 CTGAGCCCTGAACAAAGACAGGG - Intronic
938354395 2:130629246-130629268 CTGAGCCCTGAACAAAGACAGGG + Intronic
938430816 2:131236029-131236051 CTGAGCCCTGAACAAAGACACGG + Intronic
938662482 2:133502096-133502118 ATAAGCCCAGAAGAAAGTCTTGG + Intronic
940018931 2:149136005-149136027 GTCAGCCCTCCAGAAAGCCATGG - Intronic
940432469 2:153609524-153609546 GACAGCCCTGATAAAAGGCAAGG - Intergenic
941593223 2:167445728-167445750 ATCAGCTCAAAAGAAAGGGATGG - Intergenic
943473361 2:188323299-188323321 CTCAGCACAGAAGAAAGGCATGG + Intronic
944165233 2:196711715-196711737 ATCAGACCAGAAGAATGGAATGG - Intronic
945197434 2:207250432-207250454 AGTAGCCCTGGGGAAAGGCAAGG + Intergenic
945774019 2:214082079-214082101 AAGAGCCAGGAAGAAAGGCAAGG - Intronic
945860102 2:215111166-215111188 ATCAGCCCTAAAGAGAGAGAAGG + Intronic
947256763 2:228174658-228174680 ACCAGCCCTGTTGAAAAGCAAGG + Intronic
947542424 2:230988173-230988195 AGCTGCCCTGGAGAAAGGAAAGG + Intergenic
1172388590 20:34550696-34550718 AACAGCACTGAAGAGAGGCCTGG + Intronic
1173270437 20:41529579-41529601 CTCAGACCTGAAGAATGGAAAGG + Intronic
1173656954 20:44705993-44706015 CTCTGACCTGAAGAGAGGCAGGG - Intergenic
1173947373 20:46962522-46962544 CTCAGCCCTGGAGAAAGAGAGGG + Intronic
1174824599 20:53757917-53757939 ATCATCCTTGATGAAAGGAAGGG + Intergenic
1175368539 20:58471419-58471441 CGGAGCCCTGAAGAAGGGCAGGG - Intronic
1175509972 20:59517421-59517443 AACAGCAATGAAGAAAGGAAGGG - Intergenic
1175952952 20:62593229-62593251 CTCAGCCCTGAGGGAAGGCTGGG + Intergenic
1176445452 21:6816586-6816608 CTCAGCCCTGGACTAAGGCACGG - Intergenic
1176818210 21:13627677-13627699 CTGAGCCCTGAACAAAGACAGGG + Intronic
1176823620 21:13681619-13681641 CTCAGCCCTGGACTAAGGCACGG - Intergenic
1177631784 21:23738269-23738291 ATGACTCCTGAAGAAGGGCATGG - Intergenic
1179086280 21:38220741-38220763 CTGAGCCCTGAACAAAGACAGGG - Intronic
1179086620 21:38224135-38224157 CTGAGCCCTTAACAAAGGCAGGG + Intronic
1179087411 21:38229496-38229518 CTGAGTCCTGAACAAAGGCAGGG + Intronic
1179314160 21:40226413-40226435 AGCACCCCTAAAGAAATGCAAGG - Intronic
1180591397 22:16940379-16940401 ATCATCACTGATGACAGGCAAGG - Intergenic
1181135760 22:20765108-20765130 CTCAGCCATGAAGAATGACACGG - Exonic
1181887547 22:26033304-26033326 ATATTCCCTGAAGAAAGGCAGGG - Intergenic
1181962191 22:26630216-26630238 GTGAGCACTGAAGAAAGGCCAGG + Intronic
1182350460 22:29696348-29696370 ATCAGCCATGGAGAAAAGAAAGG - Exonic
1182664491 22:31947179-31947201 CCCAGCCCTGAAGAAAGCCCAGG - Intronic
1183511028 22:38235095-38235117 ATCAACACTGAAGGAAGGAATGG + Intronic
1183932720 22:41245486-41245508 GTCAGCCCTGCAGAAGGGCCCGG - Intergenic
1184321571 22:43745810-43745832 ATCAACCCAGAAGAAAGGAAGGG + Intronic
1184551210 22:45205119-45205141 CTTAGCCTTGCAGAAAGGCATGG - Intronic
949492909 3:4606511-4606533 ATCATCTCTGGAGAAAGGCAAGG - Intronic
949526297 3:4907892-4907914 AGCAACCCTGAAGGGAGGCAGGG + Intergenic
950241132 3:11371093-11371115 AGGAGCCCTGAACACAGGCATGG + Intronic
950281751 3:11713951-11713973 CTCAGCCCTGCAGGAGGGCAGGG + Intronic
950335410 3:12189034-12189056 CCCAGCCCTAATGAAAGGCAGGG + Intronic
950617928 3:14177441-14177463 ATCAGCCCTGGTAAAAGCCATGG + Intronic
951777638 3:26326651-26326673 ATCAGCCCTGGAGGGGGGCATGG + Intergenic
952694200 3:36246989-36247011 ACCAGGCCTGAAGACAGACAGGG + Intergenic
952923994 3:38308092-38308114 CTGAGCCCTTAAGAAAGGCCAGG + Intronic
952925099 3:38314672-38314694 TCCAGCCCTGGAGAAAGGGAGGG - Intronic
954135501 3:48580338-48580360 GGCTGCCCTGCAGAAAGGCAGGG + Exonic
954753206 3:52825096-52825118 CTGAGCCCTGAAAAAGGGCAAGG - Intronic
954872475 3:53778151-53778173 GTCCGGCCTGAAGAGAGGCAAGG - Intronic
955004164 3:54953847-54953869 AGCAGACCTGAGGAAAGGCCTGG + Intronic
955122702 3:56076804-56076826 ATAAGCCATGTAGACAGGCATGG - Intronic
956358783 3:68423399-68423421 ATGAGCCCTGAAGACAGCCCAGG - Intronic
956660414 3:71591838-71591860 ATCTATCCTGAAGAAAGCCAAGG + Intergenic
957190530 3:77003480-77003502 AGTGGCCGTGAAGAAAGGCATGG - Intronic
957531970 3:81452004-81452026 ATGTGCCCTGAAGAAAGACTTGG + Intergenic
961367651 3:126410746-126410768 ATCAGACCAGGAGCAAGGCAAGG - Intronic
961565772 3:127762401-127762423 CACAGCCCTTAAGAAAGGCTGGG - Intronic
965318947 3:167227607-167227629 TTAAACTCTGAAGAAAGGCATGG + Intergenic
965937402 3:174131155-174131177 ATTAGCCTTGGAGAAAGGCAAGG - Intronic
967079672 3:186037832-186037854 CTCAGCCCTGATGAAAGAGAAGG - Intergenic
968198237 3:196728575-196728597 ATCAGTGTTGAAGAAAGGAAAGG - Intronic
968456672 4:704007-704029 ATCATCCCAGAAGGAGGGCAGGG - Intergenic
968939834 4:3632000-3632022 ACAGGCGCTGAAGAAAGGCAAGG - Intergenic
969361120 4:6664342-6664364 ATCGGCCCGGGAGAAGGGCAGGG - Intergenic
972578683 4:40375659-40375681 ATCATCTCTGGAAAAAGGCATGG + Intergenic
974062213 4:57045613-57045635 ATCAGCTCTGAAGAAAGTACTGG - Intronic
974991809 4:69101887-69101909 ATCTCCCCTGCAGAAAGGCCTGG + Intronic
974999851 4:69209370-69209392 ATCTCTCCTGAAGAAAGGCCTGG - Intronic
976538367 4:86243653-86243675 TTAAGCCCTGAAGCAAGTCAGGG - Intronic
978578716 4:110211746-110211768 ATGAGGCCTCAAGAAAGGCATGG + Intergenic
979057466 4:116015199-116015221 CTGAGCCCTGAACAAAGACAGGG - Intergenic
979058218 4:116020511-116020533 CTAAGCCCTGAATAAAGACAGGG - Intergenic
980513441 4:133823277-133823299 ATCAGCTCTGAAGAGAGCAATGG - Intergenic
981956366 4:150478681-150478703 AAAGGCCCTGAAGCAAGGCAGGG - Intronic
981985500 4:150849767-150849789 TTCAGCACTGAAGGAGGGCATGG - Intronic
982196012 4:152915165-152915187 TTCAGCTCTTAAGAAAAGCACGG + Intronic
984210880 4:176846262-176846284 AACAGCAGTGAACAAAGGCATGG + Intergenic
984829383 4:183957782-183957804 ATCCGCCCTGAAGGAAACCACGG - Intronic
985535966 5:465944-465966 TTCAGCCCTGCAGCACGGCAAGG + Intronic
986006673 5:3674042-3674064 ATGAGCCCTGCAGGAAGGCCGGG - Intergenic
986270901 5:6229924-6229946 AGCAGACCTGAAGGAAGTCAGGG - Intergenic
986541843 5:8852661-8852683 ATCAGACTTGTAGGAAGGCAGGG + Intergenic
986894619 5:12350395-12350417 AGCAGCCCTCAAGCAAGCCAAGG - Intergenic
986947488 5:13041929-13041951 CTCGGACCTGAAAAAAGGCAAGG + Intergenic
988137218 5:27189215-27189237 ATAAGCCATGAAGCCAGGCAAGG - Intergenic
988484222 5:31655040-31655062 ATCAGACCTGAAGGAAGTGAGGG - Intronic
988621875 5:32831526-32831548 CTGAGCTCTGAAGAGAGGCATGG + Intergenic
989241411 5:39206877-39206899 ATCAGCCCTAGAAAAAGGCAAGG - Intronic
989566882 5:42909816-42909838 TGCAGGCCTGCAGAAAGGCAGGG + Intergenic
991412071 5:66355614-66355636 ATCATCCATGCAGGAAGGCAGGG + Intergenic
992734428 5:79704593-79704615 ATCAACCAAGAACAAAGGCAGGG - Intronic
992772618 5:80062464-80062486 ATTAGCTTTGAAGAAGGGCAGGG + Intronic
992927813 5:81608394-81608416 ATGAGGACTGAAGAAAGGCAAGG - Intronic
994737727 5:103576359-103576381 ATCAGGAATGAAGAAAGGAAGGG + Intergenic
995716966 5:115090114-115090136 ATCAGTCCTTGAGAAATGCAAGG - Intergenic
997716742 5:136048225-136048247 AGCAACCCAGAAGAAAAGCATGG - Intronic
998199881 5:140111352-140111374 ATCAGCACGGAAGAAAGGCAGGG + Intronic
998374263 5:141680923-141680945 ATCAGCTCTGGAGTAAGGTAGGG + Intronic
1000369989 5:160525882-160525904 ATCACCCCTGGAGAAATGAAGGG - Intergenic
1000719261 5:164685757-164685779 ATAATCCCTGAAGAAATACATGG - Intergenic
1001317470 5:170654119-170654141 TTGAACCCTGAAGAAGGGCAAGG - Intronic
1001803653 5:174565113-174565135 CTCAGCCCTGTATAAATGCATGG + Intergenic
1003444105 6:6169228-6169250 ATCAGCCCTGCAGACAGCCTGGG + Intronic
1004050630 6:12075078-12075100 GTCAGCCCTGAGGAAAGGGGCGG - Intronic
1004853073 6:19720179-19720201 ATTAATCATGAAGAAAGGCAAGG - Intergenic
1006176398 6:32124669-32124691 ATCCACTCTGAAGAAATGCAGGG + Intronic
1006223757 6:32518868-32518890 TACAGCCCTGATGTAAGGCACGG + Intronic
1006266742 6:32931863-32931885 AACTGCCTTGAAGCAAGGCATGG - Intergenic
1006446031 6:34080207-34080229 GTCACCCCTGCAGAAAGCCAGGG + Intronic
1007427913 6:41759241-41759263 AGCAGCCCTGAAGAAAGCAGGGG + Intergenic
1009397403 6:63215190-63215212 CTGAGCCCTGAACAAAGACAGGG - Intergenic
1009625914 6:66138835-66138857 ATGAGCCCTGAAGAAAGCTCAGG + Intergenic
1011286563 6:85730916-85730938 ATCATCTTTGGAGAAAGGCACGG - Intergenic
1011295642 6:85824755-85824777 ATCAGCCTTGATGAAATGCTTGG + Intergenic
1013787109 6:113794131-113794153 AACATCCCTGAAGGAGGGCAGGG - Intergenic
1013815753 6:114095411-114095433 ATCAGCCCTGAAGAAAGGCATGG - Intronic
1014002308 6:116378132-116378154 ATCTTCCCTGAAGAAAAGAAGGG + Intronic
1014307253 6:119758055-119758077 ATCAGCCCTGATGAGTGGAAGGG - Intergenic
1015366647 6:132403107-132403129 TTCAGCCATGAAGAAAGGAAGGG + Intergenic
1018183368 6:161243679-161243701 GTCAGCCCGGGAGAGAGGCAGGG - Intronic
1018735186 6:166682481-166682503 GACAGCCCTGGGGAAAGGCAGGG + Intronic
1018887928 6:167957100-167957122 GTCAGCCATGGAGACAGGCAGGG - Intronic
1020276635 7:6628571-6628593 ATCAGGCCTGGAGTAGGGCAAGG + Intergenic
1020805036 7:12778848-12778870 AACAAGACTGAAGAAAGGCATGG + Intergenic
1020833236 7:13116645-13116667 ATCTCCCCTGAAGAAAGAGATGG - Intergenic
1022139665 7:27482330-27482352 TTCAGCCCAGAAGAGAGGGAAGG + Intergenic
1023485638 7:40683377-40683399 GCCTGCCCTGAAGAAAGGAAGGG - Intronic
1024113259 7:46168835-46168857 ATTTGCCCCGAAGAAGGGCATGG - Intergenic
1025823164 7:64990417-64990439 CTGAGCCCTGAACAAAGACAGGG + Exonic
1026102386 7:67393866-67393888 TTCAGCCCTGAAGAAGGGCGTGG - Intergenic
1026343423 7:69453569-69453591 ATCATCCCAGAAGAAAGTCCTGG - Intergenic
1029609105 7:101617168-101617190 TTGAGCACTGAAGAAAGGAAGGG - Intronic
1031118039 7:117689606-117689628 CTGAGCCCTGAAGGAAGCCAGGG + Intronic
1031594254 7:123629777-123629799 ATCAGCCCTGAAGACTCGCCTGG - Intronic
1031965654 7:128026491-128026513 ACTAGCACTGAAGAAATGCAGGG + Intronic
1031975375 7:128090255-128090277 ATCAGCCCTGAGAAGTGGCAAGG - Intronic
1033387406 7:140891832-140891854 AACAACCCTGAAAAAATGCAAGG + Intronic
1033553221 7:142466305-142466327 TTCAGTCCTGCAGAAAGGCTTGG - Intergenic
1033789383 7:144773264-144773286 CTAAGCTCTGAAGAAAGGGATGG + Intronic
1033915148 7:146315015-146315037 ATTAGCACTGGAGAAAGCCAGGG + Intronic
1035203934 7:157282466-157282488 ATCAGCCTTAAAGACAGGGAGGG - Intergenic
1035607226 8:937930-937952 ATCAGCACTGCAGAAAGGCCGGG - Intergenic
1037082269 8:14802152-14802174 ATCAGCACTCTAGAAAGGCAAGG + Intronic
1038644756 8:29352163-29352185 CTCCGCCCGGAACAAAGGCATGG - Intergenic
1041616140 8:59908200-59908222 ATCAGCCCTGAAGACAGCACAGG - Intergenic
1042652760 8:71061235-71061257 GAGAGCCCTCAAGAAAGGCAGGG - Intergenic
1043269981 8:78320480-78320502 AGCAGCAGTGAATAAAGGCATGG + Intergenic
1043752219 8:83952093-83952115 ATGTGTCCTAAAGAAAGGCATGG + Intergenic
1043949345 8:86290756-86290778 ATCTGCCGTGCAGAAAGGCAGGG - Intronic
1046752022 8:117936214-117936236 ATCTGCTCAGAAGACAGGCAGGG - Intronic
1048124041 8:131612927-131612949 ATGACCCCTGAGAAAAGGCAAGG - Intergenic
1048774394 8:137929879-137929901 ATTAGCTCTGAAGACAGGGAGGG - Intergenic
1049193932 8:141305321-141305343 AGCAGCCTTGTAGAAAGGAAGGG - Intronic
1049270229 8:141691623-141691645 ATCATCCCTCAAAGAAGGCAGGG - Intergenic
1049493683 8:142918115-142918137 CTCAGCCCTGGAGAAAGGAGAGG - Intergenic
1049813359 8:144586269-144586291 ATCAGCCCTGAGGCCGGGCACGG - Intronic
1051203439 9:14658040-14658062 ATCATTACTGATGAAAGGCAGGG + Intronic
1052226729 9:26098022-26098044 ATAAGCACTGAAGCAAGACAAGG + Intergenic
1054994241 9:71366417-71366439 AGCAGCCCTGGAGACAGCCAGGG + Intronic
1056450835 9:86715463-86715485 TTCAGACCTGAAGAAAGGGCTGG + Intergenic
1057016141 9:91654610-91654632 ATCAGTCCTGTAGACATGCATGG + Intronic
1057944035 9:99309104-99309126 ATCAGTCCAGATGAAAGTCATGG + Intergenic
1058139081 9:101339189-101339211 ATTAGCCCTGTAGAAGGCCATGG + Intergenic
1059182523 9:112231084-112231106 ATCAGCCAGGCAGAAAGGGAGGG - Intronic
1060245649 9:121943928-121943950 ATCAGACATGAAGAAAGAAATGG - Intronic
1060947131 9:127576398-127576420 AACAGCACTGAAGTCAGGCAGGG + Intronic
1061248630 9:129414078-129414100 ATCCGCCCGGAACAATGGCAGGG - Intergenic
1062042870 9:134412158-134412180 AGCAGCCCTGGAGAAAGCTATGG + Intronic
1062050743 9:134445410-134445432 ATCAGCCCTTAGGACAGTCAAGG + Intergenic
1203523743 Un_GL000213v1:67939-67961 CTCAGCCCTGGACTAAGGCACGG + Intergenic
1203529149 Un_GL000213v1:121826-121848 CTGAGCCCTGAACAAAGACAGGG - Intergenic
1186540851 X:10398320-10398342 ATCAGCAATGGAGAAAGCCAAGG - Intergenic
1187137440 X:16561668-16561690 ATAAGCACTAAAGAAAGGCAGGG + Intergenic
1187419125 X:19120040-19120062 AAAAACACTGAAGAAAGGCAGGG - Intronic
1188694035 X:33166240-33166262 ATCATCGCTGAGAAAAGGCAAGG + Intronic
1190728720 X:53210296-53210318 AACAGCAATGAAGAAAGGCCAGG + Intronic
1190906143 X:54730305-54730327 ATCAGCCTTGAAGGAGGACAGGG + Intergenic
1190949403 X:55128071-55128093 ATAAGCCCTGATGAATGTCAAGG - Intronic
1193370018 X:80684441-80684463 ATCAGCCTTTAAGCAAGACATGG - Intronic
1195469990 X:105220052-105220074 ATCAGACCTGAAGAAGCTCAGGG - Exonic
1196970766 X:121105962-121105984 ATCTGACCTGAAGAAATACAGGG + Intergenic
1197329733 X:125138888-125138910 GTCATCCCTGGAGAAAGGGATGG - Intergenic
1197945287 X:131831941-131831963 ATCATCTTTGAAGAAAGGCATGG - Intergenic
1198448023 X:136738023-136738045 ATAGGCCCAGAAGAGAGGCAAGG - Intronic
1199132217 X:144202991-144203013 CTGAGCCCTGAACAAAGACAGGG - Intergenic
1199381125 X:147173953-147173975 CTGAGCCCTGAACAAAGACAGGG - Intergenic
1201857995 Y:18566650-18566672 CTGAGCCCTGAACAAAGACAGGG + Intronic
1201875326 Y:18753731-18753753 CTGAGCCCTGAACAAAGACAGGG - Intronic