ID: 1013815755

View in Genome Browser
Species Human (GRCh38)
Location 6:114095416-114095438
Sequence TAGCCATCAGCCCTGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 126}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013815755_1013815760 9 Left 1013815755 6:114095416-114095438 CCTTTCTTCAGGGCTGATGGCTA 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1013815760 6:114095448-114095470 CACATGAATATGGGAGAGGGAGG 0: 1
1: 0
2: 6
3: 189
4: 3068
1013815755_1013815756 -1 Left 1013815755 6:114095416-114095438 CCTTTCTTCAGGGCTGATGGCTA 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1013815756 6:114095438-114095460 ACAAGATGCTCACATGAATATGG 0: 1
1: 0
2: 0
3: 11
4: 152
1013815755_1013815763 30 Left 1013815755 6:114095416-114095438 CCTTTCTTCAGGGCTGATGGCTA 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1013815763 6:114095469-114095491 GGGAGGCAGCAGAATTACCAAGG No data
1013815755_1013815761 10 Left 1013815755 6:114095416-114095438 CCTTTCTTCAGGGCTGATGGCTA 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1013815761 6:114095449-114095471 ACATGAATATGGGAGAGGGAGGG 0: 1
1: 0
2: 3
3: 41
4: 446
1013815755_1013815759 6 Left 1013815755 6:114095416-114095438 CCTTTCTTCAGGGCTGATGGCTA 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1013815759 6:114095445-114095467 GCTCACATGAATATGGGAGAGGG 0: 1
1: 0
2: 3
3: 31
4: 491
1013815755_1013815758 5 Left 1013815755 6:114095416-114095438 CCTTTCTTCAGGGCTGATGGCTA 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1013815758 6:114095444-114095466 TGCTCACATGAATATGGGAGAGG No data
1013815755_1013815757 0 Left 1013815755 6:114095416-114095438 CCTTTCTTCAGGGCTGATGGCTA 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1013815757 6:114095439-114095461 CAAGATGCTCACATGAATATGGG No data
1013815755_1013815762 13 Left 1013815755 6:114095416-114095438 CCTTTCTTCAGGGCTGATGGCTA 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1013815762 6:114095452-114095474 TGAATATGGGAGAGGGAGGGAGG 0: 1
1: 0
2: 5
3: 84
4: 931

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013815755 Original CRISPR TAGCCATCAGCCCTGAAGAA AGG (reversed) Intronic
902225238 1:14992512-14992534 TGGCCAACAGCCCTGGAGGAGGG - Intronic
902656801 1:17874685-17874707 TAGATGGCAGCCCTGAAGAACGG - Intergenic
903803894 1:25990430-25990452 CAGGCATCTGCCCTCAAGAAAGG + Intronic
908323720 1:63003024-63003046 GAGCCATCAGCCCTGATTACTGG + Intergenic
909367373 1:74843493-74843515 TAACCATCAGTCCTGCAGAAGGG - Intergenic
910104605 1:83618241-83618263 TGGGCATCAGCGCTGAAGAGCGG - Intergenic
911480783 1:98437611-98437633 TAGCCAACATCCTTGATGAAAGG + Intergenic
915845180 1:159255554-159255576 CAGCCATCAACACTGAAGCAAGG - Intergenic
919062035 1:192645617-192645639 TGCCCATCCGCCCAGAAGAATGG + Intronic
920161036 1:203997718-203997740 TGGCCATCAGGCCTAAGGAAGGG - Intergenic
920381103 1:205534961-205534983 TAGACATCAGCCCTGACCACTGG - Intergenic
1065727485 10:28679758-28679780 TAGTCATCACCCCAGAAGACTGG + Intronic
1066521779 10:36228311-36228333 TTGCCATCAGCACTCAAGACAGG - Intergenic
1068261915 10:54594329-54594351 TAGACATTAGCCCTAAGGAAAGG + Intronic
1068375588 10:56175354-56175376 TAGCCATCAACATTGGAGAAAGG + Intergenic
1069049023 10:63772682-63772704 TAGCCATCAAGCCAGGAGAAAGG + Intergenic
1070372023 10:75791725-75791747 TTGTCATCAGCCCTGGAGAAAGG + Intronic
1071457180 10:85859966-85859988 CAGCCATCTTCCCTGAGGAAAGG - Intronic
1071784456 10:88882789-88882811 TATGCATCAGCCCTAAGGAATGG - Intronic
1074289442 10:112127387-112127409 TTGCCATCAGCCTTGTAAAAGGG + Intergenic
1075139544 10:119818920-119818942 TAACCATAAGCCCTGCAAAAAGG - Intronic
1076538009 10:131195442-131195464 TAGCCGTCAGCCTTGAAAAGCGG - Intronic
1078566197 11:12416572-12416594 GCGCCATCTGCCCTGATGAAGGG + Intronic
1079405822 11:20144779-20144801 TTGCCTATAGCCCTGAAGAATGG - Intergenic
1080138648 11:28888879-28888901 TCTCCATGAGCCCTTAAGAAAGG - Intergenic
1080895709 11:36447575-36447597 AAGCCATCTTCCCTGAGGAAGGG - Intronic
1081453590 11:43198084-43198106 TGGTCATCAGGCCTGAGGAAGGG + Intergenic
1082835992 11:57650300-57650322 TGGACACCAGCCCTGAAGCAGGG + Intronic
1085010621 11:73139052-73139074 TAGTCATAAACCCTGAAGACAGG + Intronic
1086931078 11:92693894-92693916 TAGGCCTCAGGCATGAAGAAGGG - Intronic
1087678773 11:101194033-101194055 GAGACAACAGCCATGAAGAAAGG + Intergenic
1089422893 11:118344802-118344824 TAGCCCCCAGCTCTGAAGTAGGG - Intronic
1092362785 12:7851332-7851354 TAGTCATCACCCCGGAAGAAAGG + Intronic
1097057029 12:56256562-56256584 TTCCCATCAGCCCTGAAGACAGG - Intronic
1098060862 12:66560832-66560854 TAGGTATAAGCCCTAAAGAAAGG + Intronic
1098645435 12:72894882-72894904 TTGCCATCAGCTTAGAAGAATGG + Intergenic
1099954481 12:89339893-89339915 CAGCCATCAAACCTGAAAAATGG + Intergenic
1102418239 12:112783146-112783168 TATCCAGCAGGCTTGAAGAATGG - Intronic
1103880351 12:124161276-124161298 TTGCCATCAGCAGTGTAGAAGGG + Intronic
1104100883 12:125608199-125608221 TAGCCATGAGCCATGAATGAAGG + Intronic
1104285961 12:127425039-127425061 TAGCCATCACCTGAGAAGAAAGG - Intergenic
1105634317 13:22202709-22202731 GAAACATCAGGCCTGAAGAAGGG - Intergenic
1107347554 13:39478489-39478511 TAGCCATCACACCTGGATAATGG - Intronic
1108672876 13:52709650-52709672 CAGCCATCAGCCCTGCTGCAGGG - Intronic
1110640895 13:77822595-77822617 TTGCTATGAGCCCTGAAGATCGG - Intergenic
1118322690 14:64762654-64762676 CAGCCAGCAGCCCTGGAGAAAGG - Intronic
1119566508 14:75633618-75633640 CAGCATTCAGACCTGAAGAAGGG - Exonic
1119586023 14:75836037-75836059 TAGGTATCTGCCCAGAAGAAGGG + Intronic
1119813843 14:77547433-77547455 AAGCTGTCAGCCCTGAAGACAGG + Intronic
1125324604 15:38524280-38524302 TCACCATCAGCACAGAAGAATGG + Intronic
1125503527 15:40253549-40253571 CAGGCATCAGACCTGAAGATGGG - Intronic
1129186604 15:73911089-73911111 GAGCCATCAGCCCTGCGGGAGGG + Intergenic
1139084651 16:63570057-63570079 GTGCCAGCAGCCCTGGAGAATGG + Intergenic
1142551725 17:744902-744924 AGGGCATCGGCCCTGAAGAACGG - Exonic
1145277546 17:21442439-21442461 TAGCCATCAACACTGAGGCAAGG - Intergenic
1145315382 17:21728333-21728355 TAGCCATCAACACTGAGGCAAGG - Intergenic
1145713812 17:27000270-27000292 TAGCCATCAACACTGAGGCAAGG - Intergenic
1146930842 17:36776839-36776861 TAGCCATCACCCAGGGAGAATGG - Intergenic
1147690785 17:42313145-42313167 TAGCCACCAGCCCGGAGGTAAGG - Intergenic
1148330069 17:46808928-46808950 TAGCTAACAGCCCTGAACTATGG - Intronic
1151321432 17:73354858-73354880 AAACCATCAGCCCTGGGGAAGGG - Intronic
1160200914 18:76794530-76794552 TAGCCTTCAGCCTTGACTAATGG - Intergenic
1160769454 19:823771-823793 TCCCCAACAGCCCTGGAGAAGGG + Intergenic
1162248157 19:9420086-9420108 CAGCCATCAGCCCTGTGGGATGG - Exonic
1163206794 19:15809185-15809207 TAGCCATCAGACAGAAAGAAGGG + Intergenic
1165911424 19:39230646-39230668 TAGAGCTCAGCTCTGAAGAAAGG - Intergenic
1168279950 19:55300175-55300197 TAGCCACCAGCCATGAAGCAGGG - Intronic
924975204 2:167178-167200 GAGCCATCGACCCTCAAGAATGG + Intergenic
925009368 2:470716-470738 AAACTATCAGCACTGAAGAAAGG + Intergenic
926231058 2:11004420-11004442 TAGGCCTCAGCTCTGCAGAAAGG + Intergenic
927133816 2:20082240-20082262 TAGCCCTCTGCCCTCAAGGATGG + Intergenic
927701091 2:25269433-25269455 TTGGCCTCAACCCTGAAGAATGG + Intronic
927998927 2:27506449-27506471 AAGCCACCAGCTCTCAAGAAGGG - Intronic
931632271 2:64311908-64311930 TAGACAGCAGCCCTGACGCATGG - Intergenic
933698375 2:85237080-85237102 TTCCCATCTGCCCTGAAGTATGG + Intronic
941190905 2:162380542-162380564 GAGCCATAAGCCATGAAAAATGG + Intronic
944172581 2:196796323-196796345 TAGCCATCAGGCCCTAAAAAAGG - Intronic
945386720 2:209209717-209209739 CAGCCAACAGCCCAGAAGCAAGG - Intergenic
948373342 2:237504598-237504620 CAGCCCTCAGCCTTGCAGAAGGG + Intronic
1172504128 20:35448726-35448748 GAGCCATCAGGCCTGACCAAGGG + Intronic
1173270436 20:41529574-41529596 TTGCACTCAGACCTGAAGAATGG + Intronic
1175752644 20:61509637-61509659 TAGCCTTCAGCCCTGGAGTGTGG - Intronic
1182033066 22:27175164-27175186 TAGCCCCCAGCACTGAACAAAGG + Intergenic
1182292442 22:29291400-29291422 GAGCAAGCTGCCCTGAAGAAAGG + Intronic
1182372496 22:29821355-29821377 GTGCCATCATCCCTGAAGCAGGG + Intronic
1182782111 22:32876256-32876278 AAGTCATCAGCCCTAATGAATGG - Intronic
949657884 3:6242305-6242327 TGGTCATCCTCCCTGAAGAAGGG + Intergenic
950024009 3:9808528-9808550 TAGCCATGTGCCCTGGAGGAGGG - Intronic
952900553 3:38109234-38109256 CAGCCATAAGGCCTGAGGAAAGG + Intronic
953960014 3:47259403-47259425 TAGCCATAAGCCTTGCTGAAGGG - Intronic
955902984 3:63777042-63777064 TTGCCTTCAGCCGTGAATAAAGG + Intergenic
956966900 3:74472058-74472080 TAGCCACCAGACATAAAGAAAGG - Intronic
962412374 3:135152544-135152566 AAGCCATCAGACCATAAGAAAGG + Intronic
963427522 3:145151044-145151066 CTGCCCTCAGCCCAGAAGAAAGG - Intergenic
969062954 4:4453373-4453395 TAGCCATCAACACTGAGGCAAGG + Intronic
970608922 4:17707854-17707876 TAGCCATCAGACCTGAAAGGCGG + Intronic
970847643 4:20561151-20561173 TAGCCATGAGCTCAAAAGAAAGG + Intronic
974808330 4:66912190-66912212 ATGACATCAGTCCTGAAGAAAGG - Intergenic
988098841 5:26653128-26653150 TAGCCATCTACCATGAAGGAAGG - Intergenic
990665837 5:58070279-58070301 TACCCAACTGACCTGAAGAAAGG + Intergenic
991508326 5:67349705-67349727 GAGCATGCAGCCCTGAAGAAAGG - Intergenic
994954244 5:106506866-106506888 TTGCCATCAGCCGTGTACAAGGG - Intergenic
998199879 5:140111347-140111369 CAGCAATCAGCACGGAAGAAAGG + Intronic
999151147 5:149427070-149427092 TCTCTCTCAGCCCTGAAGAAAGG + Intergenic
999940246 5:156534512-156534534 TAGCCTTCAGCCATGCAGGAAGG + Intronic
1001512612 5:172334477-172334499 TACACAACAGCCCTGCAGAACGG + Exonic
1004289176 6:14350848-14350870 GAGCCAACAGACCAGAAGAAAGG - Intergenic
1004916844 6:20340390-20340412 CAGCCCCCAGCCCTGGAGAAAGG + Intergenic
1005179014 6:23082359-23082381 TAAAAATAAGCCCTGAAGAATGG + Intergenic
1009852585 6:69216453-69216475 TTGCCATCGGCCCAGGAGAAAGG + Intronic
1010110828 6:72228764-72228786 TTCCCATCAGCCATGTAGAAAGG + Intronic
1011928817 6:92683752-92683774 TGGACATCAGTCATGAAGAAAGG + Intergenic
1013815755 6:114095416-114095438 TAGCCATCAGCCCTGAAGAAAGG - Intronic
1017914724 6:158822721-158822743 GAGCCATAAGTCCTGGAGAAGGG - Intergenic
1021471860 7:21012324-21012346 TGGCCAGCAGCCCTGACTAAAGG + Intergenic
1027365004 7:77448134-77448156 CAACCAGCAGCCCTGAGGAATGG - Intergenic
1028232505 7:88322489-88322511 CAGCCATTAGCCCTAAAGAGAGG - Intergenic
1031522966 7:122788874-122788896 TAGCCACCAGCACTGAGGAAAGG + Intronic
1032555228 7:132825884-132825906 AAGCCATCAGTTCTGAAAAAGGG - Intronic
1033626263 7:143112649-143112671 TAGCCACAACCCCTGCAGAAAGG + Intergenic
1041960131 8:63605355-63605377 AACCAATCTGCCCTGAAGAAAGG - Intergenic
1042741953 8:72059038-72059060 AAGCCACCAGGGCTGAAGAAGGG + Intronic
1043554935 8:81420332-81420354 TAGCCACCATCCCTGATGGATGG + Intergenic
1045064578 8:98434307-98434329 TAGCCACCATCCCTGCAGCAAGG + Intronic
1051576101 9:18617402-18617424 TAGGCATCAGGCCTGCAGTAGGG - Intronic
1057187274 9:93063802-93063824 TAGCCAGCTGACCAGAAGAAGGG - Intronic
1187137438 X:16561663-16561685 TAGCAATAAGCACTAAAGAAAGG + Intergenic
1190359250 X:49633940-49633962 TAAGCATCAGCCCTGTAAAAGGG + Intergenic
1195936498 X:110130844-110130866 TTTCCATCAGCACTGAAGGATGG - Intronic
1196113283 X:111970160-111970182 TAGTCATCAGCCTTAATGAATGG - Intronic
1196293017 X:113965952-113965974 TAGACCTCAGCCAAGAAGAAAGG - Intergenic
1198226849 X:134653174-134653196 GAGCCATCAGGCCTGAGGAGAGG - Intronic
1200072221 X:153534912-153534934 TGGCCCAGAGCCCTGAAGAAAGG - Intronic
1201283679 Y:12361530-12361552 ATTCCCTCAGCCCTGAAGAAGGG + Intergenic