ID: 1013815757

View in Genome Browser
Species Human (GRCh38)
Location 6:114095439-114095461
Sequence CAAGATGCTCACATGAATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013815753_1013815757 5 Left 1013815753 6:114095411-114095433 CCATGCCTTTCTTCAGGGCTGAT 0: 1
1: 0
2: 1
3: 24
4: 306
Right 1013815757 6:114095439-114095461 CAAGATGCTCACATGAATATGGG No data
1013815755_1013815757 0 Left 1013815755 6:114095416-114095438 CCTTTCTTCAGGGCTGATGGCTA 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1013815757 6:114095439-114095461 CAAGATGCTCACATGAATATGGG No data
1013815752_1013815757 6 Left 1013815752 6:114095410-114095432 CCCATGCCTTTCTTCAGGGCTGA 0: 1
1: 0
2: 2
3: 31
4: 257
Right 1013815757 6:114095439-114095461 CAAGATGCTCACATGAATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013815757 Original CRISPR CAAGATGCTCACATGAATAT GGG Intronic
No off target data available for this crispr